Chalkhills Digest Volume 9, Issue 24
Date: Friday, 16 May 2003
Chalkhills Digest, Volume 9, Number 24
Friday, 16 May 2003
Topics:
New Blur album
uncool and proud of it
She's got a record to hide (and she don't care)
re: hiding cd's...
...fast and bulbous. Got me?
dirty secrets
Re: Embarassing cd's
Re: The only pleasure worth having
Summer Sons and Daughters
Radio Hidebound
Woodshedding XTC, the new Cottage Industry!
Re: Embarassing cd's and other non-XTC rambling
Carly Simon: embarrassing?
XTC Tribute in NYC, June 6, 7, 11, 13, 14
Administrivia:
To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
<chalkhills-request@chalkhills.org> with the following command:
unsubscribe
For all other administrative issues, send a message to:
<chalkhills-request@chalkhills.org>
Please remember to send your Chalkhills postings to:
<chalkhills@chalkhills.org>
World Wide Web: <http://chalkhills.org/>
The views expressed herein are those of the individual authors.
Chalkhills is compiled with Digest 3.7d (John Relph <relph@tmbg.org>).
Well would you want me / In your afternoons?
---------------------------------------------------------------------- Date: Wed, 14 May 2003 15:22:42 +0100 (BST) From: Chris Clee <cmc@sanger.ac.uk> Subject: New Blur album Message-ID: <Pine.OSF.4.44.0305141521300.62791-100000@bach.sanger.ac.uk> well i don't post very often but the new albarn album is well....stunning <.\\< TGCCATCGGATCTCCTGCCTAGAGGAG
------------------------------ Date: Wed, 14 May 2003 07:42:25 -0700 (PDT) From: Jackson <jydson@yahoo.com> Subject: uncool and proud of it Message-ID: <20030514144225.28316.qmail@web10808.mail.yahoo.com> Perhaps the most embarrassing but loved cd in my collection? Butch Cassidy and The Sundance Kid soundtrack by Burt Bachrach
------------------------------ Date: Wed, 14 May 2003 10:00:50 -0700 From: "Richard" <rjpa1@attbi.com> Subject: She's got a record to hide (and she don't care) Message-ID: <041501c31a3a$5f854260$05081fac@verisity.com> I don't have to hide anything in my collection. My collection has been co-mingled with my wife's collection (I regularly thank a random deity that she never replaced the Peter Allen vinyl with CDs!) so anything that would twist a Chalkhill eyebrow gets blamed on her. She's okay with that. Cheers, Richard
------------------------------ Date: Wed, 14 May 2003 11:15:40 -0400 From: "Danny Phipps" <phipps@schoollink.net> Subject: re: hiding cd's... Message-ID: <web-42009262@schoollink.net> <in chalkhills vol. 9, no. 23, the returning tyler hewitt doth spake>: >Supposed you are hosting a Chalkhills party. >Everyone on this list will be >coming to your house. Even Harrison Sherwood. Now >you know that the first >thing we all will do is head straight for your CD >collection to "figure you >out"....The question is, which of your CDs are you >going to remove from your collection and hide under >the couch simply because you are ashamed to let >fellow XTC fans know you own and enjoy these discs? welcome "home," tyler!! glad to have you back, bud. :-) i don't usually post to chalkhills much, rather relegating myself to "lurk mode" 90% of the time....but this question i felt i'd like to personally answer -- i think i'd have to hide the following artists' cd's from my collection either under the covers or in the closet should the distinguished people of this list ever become guests in my home -- * bread (one "best of") * buggles (their entire catelogue of TWO albums!) * carpenters (a boxed set) * GTR (heh-heh! no comment...) * michael jackson (7 albums by *it*!) * KISS (you wouldn't believe my KISS collection!!!) * kenny loggins (a "best of") * the monkees (a boxed set) * prince (2 albums and a boxed set) * reo speedwagon (a "best of") i'm sure there are others i've overlooked, too. but you get the main jist of my meaning. ;-) good question, tyler!! :-) /danny (back to "lurking mode")
------------------------------ Date: Wed, 14 May 2003 11:19:41 EDT From: Jxnsmom@aol.com Subject: ...fast and bulbous. Got me? Message-ID: <186.19c440c3.2bf3b88d@aol.com> Said Tyler: <<The only thing in my collection I would find slightly embarassing is Abba Gold, but I got that for free when I worked in a record store, so it's not like I paid money for it!>> I paid for it, and it was worth every penny just to enjoy the cheesiness of Chiquitita. My embarassing freebie is Neil Diamond Live. I love his songs (again, that magnetic cheesiness!), but his vocal performance on it is pretty bad. <<I could empty a busy store at closing time by putting the barking dogs version of Jingle Bells on repeat.>> Oops, own that one, too. <<I myself have broken up parties by playing Trout Mask Replica >> I'd be moving TOWARD your party faster than a squid eating dough in a polyethylene bag... Said Wayne: <<I'd even put out my old Banana Splitz 45's. Sha-la-la, la-la-la....>> Very cool! Since the early 1970s, I've held onto: a boxed six-pack of Sesame Street 45s; a "Howdy Doody Dos and Don'ts" 45 with little songs about washing your hands, being polite to mom, and saying your prayers at bedtime that I won at a school fun fair around age 6; and a Disney movie songs album with a big chunk broken out of it that includes nothing past about 1960. OK, I might actually get embarassed by my Muppet Movie soundtrack and my Captain and Tenille album. I won the latter in 4th grade (1977) by composing and recording an original story with music for a radio contest. Actually, I won a gift certificate to a record store, and I remember Mom and Dad taking me there. I held in my right hand a copy of Boston's classic album, and in the left hand, Captain and Tenille. I was very torn, and finally sided with C& T only because my older brother already owned the Boston album, so I knew I could hear it any time. Just to redeem myself somewhat, I should tell you that in that same year (4th grade), I acquired David Bowie's Changes One and Queen's Night at the Opera, and already was the proud owner of a few ELP albums. Boy, the kids HATED it when I used to bring those to school on rainy days to play in the gym at indoor recess. I'd be trying to point out the cool recording tricks Queen was using, or David's awesome vocal quality, and they were standing there with their Kiss and Shaun Cassidy albums ready to beat me up. Amy
------------------------------ Date: Wed, 14 May 2003 10:38:37 -0500 From: Sharon.Olsen@verispan.com Subject: dirty secrets Message-ID: <OF53A08ED4.AE94C3AE-ON86256D26.00555E86@smgusa.com> >The question is, which of your CDs are you >going to remove from your collection and hide under >the couch simply because you are ashamed to let >fellow XTC fans know you own and enjoy these discs? I have no shame in any of my CDs and will proudly show a Taco CD and 3 New Kids on the Block CDs. NKOTB purely for 8th grade angst nostalgia's sake and Taco? Well Taco is just damn good!
------------------------------ Date: Wed, 14 May 2003 11:45:31 -0400 (EDT) From: John Relph <relph@sgi.com> Subject: Re: Embarassing cd's Message-ID: <10305141145.ZM4888@mtv-vpn-hw-relph-1.corp.sgi.com> On Sunday, 2003, Tyler Hewitt <tahewitt@yahoo.com> wrote: > >I myself have broken up parties by playing Trout Mask >Replica and John Zorn at top volume. That reminds me that in college we used to clear the party out, usually because it was late, we were tired and we wanted to go to sleep, by playing Jean Michel Jarre's Oxygene. Everybody else realized they were falling asleep, too, and we usually didn't have to play side two. -- John
------------------------------ Date: Wed, 14 May 2003 11:51:37 -0400 (EDT) From: John Relph <relph@sgi.com> Subject: Re: The only pleasure worth having Message-ID: <10305141151.ZM4946@mtv-vpn-hw-relph-1.corp.sgi.com> On Tuesday, 2003, "WAYNE KLEIN" <wtdk12@msn.com> wrote: > >I don't believe in guilty pleasures..I'd even put out my old Banana Splitz >45's. Sha-la-la, la-la-la.... I've been playing the Banana Splits Theme as a mandolin tune (in the style of traditional fiddle tunes). I completely stumped a friend with my variations until I played the basic tune. Then I got a laugh. -- John
------------------------------ Date: Wed, 14 May 2003 15:06:56 -0400 From: KEVIN.WOLLENWEBER@jpmorgan.com Subject: Summer Sons and Daughters Message-ID: <OFED93F03C.0CBEA71A-ON85256D26.00645FB9@chase.com> Hey, Children: Haven't actually commented for a while, but I've been reading and am enthused by some of the talk I've been checking out here. Right now, my album of the moment is the new, utterly fantastic (and minimally packaged) disk by Yo LaTengo called SUMMER SUN. This is a great collection of songs, perhaps the strongest collection I'd heard from them in a long time! They get steadily better with each new release. And I'm ready for the next FUZZY WARBLES collections. Judging by the track list, posted in CHALKHILLS DIGEST 9-21, these should be well worth waiting for. And Mandy Moore is covering "Senses Working Overtime" and a song by the Water Boys. I'm surprised that she wasn't turned onto the songs of one Carl Wollinger, otherwise leading World Party. Hey, it's all a great way to "grow up", and she's soaking up this music so early on in her career? Someone cynnically mentioned that this might be the work of her producer, trying to slowly mold her and give her a "hipper" image, whatever that is, but I'll give her the benefit of the doubt. If this is indeed a desperate effort, I still think that the songs chosen here represent quite a step forward, and maybe she can go beyond lip synching and good-looking videos. Having never seen her, I'd had her described to me as having a slightly less sexy image than those of her generation who have gone on to some stranger notariety, but at least she's putting her efforts into better arrangements and songwriting--I realize that these are not characteristics that make you that ultimate top 40 star, but I await the album...and possibly the favorable reactions from my nephews and nieces who might be mildly curious to hear original versions of these songs. Sad to say, though, I think they'll gravitate to those wriggling the navel rings or skimpy outfits coupled with the usual mysogyny over a cup o' brew. I'd done it myself when I first learned of the world of rock and I wouldn't take that away from future generations, but I guess I'm just looking at the scenery with a bit more sophistication and a little less greed. Besides, do I really think those generations would listen to *ME*? Music will continue to be my one addiction, however, and there is much to talk about--like what I've heard of the new Daniel Lanois album, SHINE, and am anxious to get this new and strange piece of work by Lisa Germano, a rather dark album by one who has had an addiction of her own. I'd always felt that her albums were filled with darkness and strange behavior, and I genuinely liked all of 'em thus far. After hearing her albums, it was hard to connect her to her backup work with John Mellancamp, but LULLABY FOR LIQUID PIG apparently explains some of it. I've never seen her live, but it would be an interesting experience. Among the albums I have acquired recently, aside from the stunning Yo LaTengo album, Richard Thompson's THE OLD KIT BAG and Wayne Shorter's surprisingly delightful ELEGRIA, a beautiful hybrid of his ethereal Weather Report compositions and his classic jazz arrangements dating back to his days with Miles Davis. He's another cat whose music has aged well and continues to leave me rooted to the spot in awe once the album is finished. It is amazing how close his style on this new album sounds to that of Sonny Rawlins both then and now, with a dash of Charles Mingus thrown in there as well--all of 'em true masters of their art! Well, since prog is given such short shrift when it comes to the critics talking about music's history, I guess I should feel ashamed to own good chunks of the catalogues of Emerson, Lake & Palmer (ELP), Yes, Genesis and the like, but like one other CHALKHILLion, I would still display 'em proudly should I ever throw such a party...and I guess that the forthcoming Mandy Moore album would be in there somewhere. Again, I wish her well, and she brings to mind the scared and unsure young actress Alannis Morriset; has anyone ever seen those appearances on Nickelodeon's old program, "YOU CAN'T DO THAT ON TV ANYMORE"? She seemed to me like a deer caught in the headlights! She clawed her way out of that green slime and had done reasonably well for herself, so why shouldn't Mandy? And let the summer roll on. There should be much to talk about, musically, as the months whiz by. Still no word about Becki DiGregorio starting work on her psychedelic album, but she had written me a note recently on how elated she was to be graduating and finishing her last semester. Hey, life happens, and being an artist is not all that easy. I heard even Peter Holsapple currently has a day job! Waddaya gonna do? Good luck to us all. This world isn't over yet, although there have been times when I wish it would cease to be. The white noise on radio and TV does not belong to intelligence and artistic construction, but it is seeping into the mold in small drops. Even if it is a little girl with body augmentations who wants to kick up her crippling high heels, at least it is something. Kevin
------------------------------ Date: Wed, 14 May 2003 16:33:26 -0400 From: "BramnBill" <bramnbill@rcn.com> Subject: Radio Hidebound Message-ID: <LNEMJPIEHEGGOFBMNBFGCEAICCAA.bramnbill@rcn.com> I checked this web station out. It's better than any of the other radios in motion. In my listen I heard some of my favs back to back to back. Including a song from the gods of Swindon, The Man Who Sailed Around his Soul. The next song was from another one of my all time favorites Dwight Yoakam's Honky Tonk Man. Now it's Toad the Wet Sprocket, another oldy but goody. Far Out Man, as I write this it's another XTC song!! Peter Pumpkin Head (not my favorite XTC song but there you go.)I'd probably listen more if I only had better computer speakers. Bill Check it out if you haven't already. www.live365.com. http://www.live365.com/stations/hidebound
------------------------------
Date: Wed, 14 May 2003 19:14:01 -0500
From: Chris Vreeland <CVREELAND@austin.rr.com>
Subject: Woodshedding XTC, the new Cottage Industry!
Message-ID: <a06001201bae885cb1adc@[24.175.32.185]>
For twenty years, nobody has the idea. Then at a party last summer, I
casually jest, "Hey Dennis, let's start an XTC cover band." He takes
me seriously. Next thing you know, XsTatiC is playing in Swindon,
then today, I notice these BOTH in the same issue:
From: Ian Dahlberg <idahlberg@socal.rr.com>
Hi ho chalkfolk!
You are cordially invited to attend the debut performance of LA's only
(?) XTC cover band Cheshire Cousin.....
-----
From: "Kehoe, Brendan" <BKehoe@craneco.com>
I just found out that the Loser's Lounge band is going to do a tribute to
XTC June 6, 7, 11, 13, 14 at Fez under the Time Cafe ...
----
Whoa.
Yes, we're still rehearsing. No, we don't have a name. Last week, we
successfully ran Peter Pumpkinhead and My Bird Performs back to back,
with me doing fretted-to-fretless gymnastic bass-changes between
songs, and put the finishing touches on Easter Theatre, which I
frankly didn't think could be done. We've found a string quartet
willing to play, if I can get the booking schedule right; and Mark
the trumpet player, figured out the one flat note he was playing, and
corrected it. He's a little more dubious about my machinations a-la
Across This Antheap, but I'm sure he'll endeavor to persevere. Holy
cow, but this is turning out to be a lot of work.
Back to it,
Chris "notes and notes!" Vreeland
--
Oh, joy. It's another website.
http://chrisvreeland.com
------------------------------
Date: Wed, 14 May 2003 22:48:31 -0700
From: strwbrry@tidepool.com
Subject: Re: Embarassing cd's and other non-XTC rambling
Message-ID: <3EC32A26.8CE406C4@tidepool.com>
Tyler Hewitt wrote:
> OK, what I'm finding here is that there are others on
> this list besides myself who have very eclectic and
> sometimes unusual tastes. John Relph likes Sergio
> Mendes? me too!
Un canny; I just recieved my Japanese import Herb Alpert presents
Brazil 66 in the mail today!
"Oo-pa-2!"
Another Steve
------------------
"I bought a new camera; it's very advanced; you don't even need it."
-Steven Wright
------------------------------
Date: Thu, 15 May 2003 09:51:38 +0200
From: jeffrey.thomas@bayercropscience.com
Subject: Carly Simon: embarrassing?
Message-ID: <OF0CDDC9E3.6CAC2988-ONC1256D27.00250E9F@bayer-ag.com>
Hi there, "Kreideberger",
This "embarrassing records" thread is great, almost amazing that I don't
recall having seen it already at regular intervals over the years here on
the 'Hills. It's enough to get me out of my self-imposed exile and back at
my computer, typing away (although I should be working).
*Most* of my really embarrassing stuff was bought back in the days when even
Gene Roddenberry hadn't thought of CDs yet, so if the question is which
*CDs* would I hide, there wouldn't be *that* many I would have to worry
about. Not that I'd really hide them -- it's not like my Penthouse
collection or something, no one should really be offended -- but there are a
few I'm sure would be the cause of some laughter. I have a record by Tracey
Ullmann (the one with "They Don't Know About Us"), one by the Pointer
Sisters (I still love "Fire", but when I got it, I bought it for 4-5 songs),
K.C. and the Sunshine Band, a great silly German Pop girl/group named
Lucilectric (and their hilarious song "Because I'm a Girl" -- with lines
like "what kind of wonderful butt is that / standing over at the bar? / and
the guy attached to the butt / just turned around to look at me..." -- pure
poetry), Sonny & Cher's Greatest Hits, and 1-2 others of that caliber.
Of course, I also have a CD or two from the likes of Glen Frey, Abba (say
what you like, and yes, it *IS* silly pop, but it is so well-crafted, I
appreciate them for being the best at their particular genre), or the
Sugababes, an ELO record, a couple by Grace Jones, Enya, "new age-period"
Clannad, Roxette, and Linda Ronstadt. Oh yeah, and I have "Face Value" by
Phil Collins. I have the Beautiful South's entire catalog, and they elicit
extreme reactions (both positive and negative).
What I absolutely don't get, though, are a few artists that are sometimes
named here in disregard and whom I believe just don't deserve the rap. Both
Chris "I'm a Secret Air Supply Fan But I'm Going To Try To Smokescreen You
On It Every Chance I Get, Which Is About 5 Time A Year" Coolidge and Molly
mentioned Carly Simon in a condescending or apologizing way in recent posts.
I'll never understand this. To me, she writes very adult lyrics about
interesting topics, has a good sense of melody and arrangement (not so good
on the middle eights, though), has now found the perfect producer and the
perfect band, an produced a couple of my favorite albums of the past years
("Have You Seen Me Lately", "Letters Never Sent"). They're not
*super-great*, no, but they're very good and certainly not embarrassing, not
to me, anyway. As with her ex-husband, James Taylor (the Beatles' first
Apple signing -- but you knew that), she seems to be "placed in a certain
drawer" as the Germans say, a drawer full of inferior and embarrassing
artists. I just don't get it, I would never put them there.
Yes, I have about 8 Carly Simon CDs, and maybe about 10 James Taylor CDs.
They will always be in the absolute forefront of my collection. Maybe not
as *far* in the forefront as the Beatles, XTC, Peter Gabriel, or the Stones,
but up there. You can all come by and see. Basically, I guess if there's
something I don't want you to see, then I probably don't want to see it
myself, so I don't have it.
But I do have Whitney Houston's first record -- as an LP. Now if we get
into LPs -- that's a different story. Ahh, the foibles of youth. How about
3 Foreigner records? Not bad enough? How about the complete solo Moody
Blues records between "Seventh Sojourn" and "Octave"? Still not bad enough?
Bee Gees, "Odessa"? Gimme awhile, I'm sure I have worse...
Redfaced in Germany...
- Jeff
------------------------------ Date: Thu, 15 May 2003 21:27:38 -0400 From: JOE MCGINTY <rastro2@earthlink.net> Subject: XTC Tribute in NYC, June 6, 7, 11, 13, 14 Message-ID: <944102BA-873D-11D7-B022-00039347194E@earthlink.net> XTC Tribute In New York City! The Losers Lounge - New York City's most revered tribute show - has announced six performances dedicated to the brilliant songs of XTC!!! The cast of The Losers Lounge - led by former Psychedelic Fur Joe McGinty - will perform six shows dedicated to the amazing musical catalogue of XTC. Each show will include everything from XTC's best-known favorites to rarities, b-sides and other gems from the stratosphere. We're not announcing the song list, but you can be sure that the classics and the eclectics will all be covered - in true Losers Lounge style!!! The Losers Lounge has been called "Essential New York" by Time Out Magazine New York. Paul Schaffer from Late Night With David Letterman has called them "The Coolest Thing Going." With ten years of sold out shows - which include tributes to the catalogues of everyone from Abba to The Zombies (with many stops in between including Lee Hazelwood, Neil Diamond, Paul Williams, David Bowie, The Kinks, Todd Rundgren , and at least 20 something more), and with a revolving door of special guest singers who have included Joey Ramone, James Iha, Debbie Harry, J Mascis, Ann Magnuson, They Might Be Giants, Richard Dreyfuss, Parker Posey, David Yazbek and a virtual "Who's Who" of New York's downtown nightlife scene - all the members of The Losers Lounge are looking forward to putting on a "live XTC experience" (there's three words that you don't hear together very often!) that is guaranteed to satisfy old fans as well as make plenty of new ones!!! Show dates are: June 6th, 7th, 11th, 13th and 14th (two shows on the 14th) At Fez under Time Cafe at Lafayette Street and Great Jones in New York City. For more information and a link to buy tickets please visit: www.loserslounge.com
------------------------------ End of Chalkhills Digest #9-24 ******************************
Go back to Volume 9.
16 May 2003 / Feedback