Chalkhills Digest Volume 7, Issue 36
Date: Tuesday, 12 June 2001
Chalkhills Digest, Volume 7, Number 36
Tuesday, 12 June 2001
Topics:
XTC featured on Virgin Radio website
Amen
AC
The REAL reason to get Homegrown/spun +
Re: Daves contribution
BS Outer Sleeves
Re: AC/ budgets
Home grown can somethings be tastier than store bought...and reissues
Re: Enough about Homespun/Homegrown!
places to buy reissues in the usa + other things...
Homegrown-n-stuff
Another connection
Re: alt.fan.andy-j-partridge
Song sequencing
alt.music.xtc... on the air?
Is it good for baseball? Is it good for the Jews?
Instant Dave
Re: Take me back to dear 'ol Blighty!
In The Deep
Guitarist chord? What?
Da boob toob
Express Yourself
Administrivia:
To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
<chalkhills-request@chalkhills.org> with the following command:
unsubscribe
For all other administrative issues, send a message to:
<chalkhills-request@chalkhills.org>
Please remember to send your Chalkhills postings to:
<chalkhills@chalkhills.org>
World Wide Web: <http://chalkhills.org/>
The views expressed herein are those of the individual authors.
Chalkhills is compiled with Digest 3.7c (John Relph <relph@tmbg.org>).
I make decisions / Influence people.
---------------------------------------------------------------------- Date: Sat, 9 Jun 2001 15:24:20 +0100 From: Ian Sutton <SuttonI.london@arriva.co.uk> Subject: XTC featured on Virgin Radio website Message-ID: <4BC0278484CBD4118B9700E018C3490602C410@ARLN_03> Check out the Virgin Radio website for a chance to win one of 5 signed sets of the remastered albums. You can also download three of the videos, and Chalkhills gets first mention in their list of XTC links. I am not connected with Virgin at all and think I've just severely jeopardised my chance of winning the albums!! Ian
------------------------------ Date: Sat, 09 Jun 2001 13:58:12 -0400 From: Molly <mollyfa0000@worldnet.att.net> Subject: Amen Message-ID: <3B2263B3.5603ADD3@worldnet.att.net> Organization: AT&T Worldnet Richard wrote: <<If you don't want to buy Homespun, Homegrown or whatever, you are not one of the people it was made for and that's okay too. It does not diminish your value as a fan. You don't have to be a completist to appreciate XTC.>> Amen, Richard. I don't like it when people think that they're bigger fans of a certain group/artist just because they own everything from that artist/group. I LOVE XTC, but I don't have all their stuff, and I don't think I want all their stuff. But that doesn't make me a lesser fan for that. I am planning on getting Homegrown, because I already have Homespun, and I like the demos, because I like how some of the songs before they get the final touches. But that's all I'm getting into. I'm not going to get the remastered albums, unless they're released in the US. I'm not spending money for Japanese imports. It's too expensive IMHO. Molly
------------------------------ Date: Sat, 09 Jun 2001 13:59:04 -0400 From: "Garret Harkawik" <funktaisia@hotmail.com> Subject: AC Message-ID: <F125ksQ6KLV47ozI9Wb00007e91@hotmail.com> >Please sate this old-fashioned luddite's curiosity, and pray tell: >what is an AC? Ac is air conditioning.
------------------------------ Date: Sat, 9 Jun 2001 15:22:00 -0500 From: "d-erelict" <magmound@texas.net> Subject: The REAL reason to get Homegrown/spun + Message-ID: <001101c0f121$d71c8840$036163d1@derek> To me, the REAL value of getting Homespun and Homegrown isn't neccessarily to "look into" the process, or to have multiple versions of songs, but I TRULY believe that many of these demo versions are FAR superior to thier over-produced studio counter-parts... when compiling a 1cd version of Apple Venus, I used the demo version Greenman, because I really feel they sucked the life out of the song in the studio... As for Homegrown, I can actually listen to Stupidly Happy and Wounded Horse, now... and I still prefer the demo version of Church of Women... what they should have done, in hindsight, is just booked some studio time to "touch up" these demos... why try and get some snooty studio musician to try and recapture the feel of your sample? I'm not so big on the really rough, Andy-talking-in-the-middle demos... but the "finished" multitrack recordings have a spark that the million-dollar studio versions simply lack, to my ears... > From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au> > Subject: AC? > Please sate this old-fashioned luddite's curiosity, and pray tell: what is > an AC? Air Conditioner... or, Air Cooler, you could say... > From: "Steve Oleson" <Steve.Oleson@oag.state.tx.us> > Subject: Blighty? Blimey! > I hadn't heard the nickname "Ol' Blighty" before the last couple of > Chalkhills. What does it mean? > - The Texian It's just an old slang term for Britain, if I'm not mistaken... d-erek
------------------------------ Date: Sat, 9 Jun 2001 14:23:26 -0700 (PDT) From: Jeff Eby <jeffaeb@yahoo.com> Subject: Re: Daves contribution Message-ID: <20010609212326.89899.qmail@web11602.mail.yahoo.com> "Seesaw" wrote >I have had to ask myself a tough question though. I have not heard any of the Dave session work have any distinctive Dave sound on it. Andy's session work is much more distinct. Is Dave just a very competent session man? Are there any of Dave's session work that you could tell he was playing on without having been told or read in the album credits? And if this is true, how much is he really missed from XTC??? Don't get me wrong, I have always loved Dave's playing and was sad to see him leave XTC, but how much of what he did was just playing what Andy told him to play?< I think Dave's influence was subtle but important. As a musician quite adept at arranging and scoring orchestration he filled a role that Andy and Colin couldn't. According to the song stories postscript when Andy did the orchestration for A.V. on computer it left Dave with very little to contribute. Personally I think Dave's greatest XTC moment is his orchestration on 1000 umbrellas. It is probably my favorite XTC song of all time and was pretty much only saved from disposal because of Dave's brilliant string arrangement. The song really reflects the miserable feelings in the lyrics but at the same time the song as a whole always cheers me up.
------------------------------ Date: Sun, 10 Jun 2001 00:38:56 +0200 From: "Mark Strijbos" <mark.strijbos@hccnet.nl> Subject: BS Outer Sleeves Message-ID: <200106092227.AAA17764@smtp.hccnet.nl> Dear Chalkers, Sorry, i've been asleep for a while, i'll try to catch up on the current events & threads ASAP > Was the black plastic bag on British copies? I've > heard of it, but have only seen the green paper one. the black plastic outer bag was isued only in Canada, all other countries used some form of green bag or outer sleeve. the sort of paper and the actual shade of green used varied wildly from country to country. yours in xtc, Mark Strijbos
------------------------------ Date: Sun, 10 Jun 2001 00:24:13 +0100 From: "Pledge" <Pledge7@btinternet.com> Subject: Re: AC/ budgets Message-ID: <000901c0f13b$4c13bba0$6a9f7ad5@oemcomputer> Chris Clee commented: From: Chris Clee <cmc@sanger.ac.uk> > >mister/miss pledge > >Out of curiosity why didn't you simply record the original tracks in >the original order and leave out the extras.....lots cheaper methinks, >i mean these days you can even cutomise your own cd's on your pc :) > >still....i have a tight budget > >TGCCATCGGATCTCCTGCCTAGAGGAG Firstly, it's mr thanks. Secondly, i couldn't be bothered and my cd writer is not hooked up on my current pc. Thirdly, I'm also on a tight budget. Much tighter than I realised when I bought those CDs on the soon to be cut up plastic :-(. Fourthly the only letters I can think to add are GFC. Paul Culname asked: From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au> Subject: AC? > >Twice I have now encountered this term, "AC". Chris Vreeland, in 'Hills ># 34, has "the AC on full blast" in his car. > >On Soulwax's magnificent "Much Against Everyone's Advice" album (cheers >Dom!), there is a hidden track at the start of the CD, in which reference >is also made to driving along with the AC on. > >Please sate this old-fashioned luddite's curiosity, and pray tell: what is >an AC? Paul, my guess is that AC relates to air conditioning. You know the thing that means you don't need to lose half your car stereo's volume out of the window on a hot day. Pledge PS Sorry for using my nickname on here. I was given it 18 or so years ago and there are still too many people I meet that would never know me by my real name. I've become so used to the name Pledge that it seemed the obvious choice for an email address. I just didn't fancy being Paul_Rodgers43982@someinternetprovider.com when I could get pledge7.
------------------------------ Date: Sat, 9 Jun 2001 19:33:06 EDT From: WTDK@aol.com Subject: Home grown can somethings be tastier than store bought...and Message-ID: <72.b78ec00.28540c32@aol.com> reissues >From popboy: >>In other words I would find it equally strange if xtc released every song from Wasp Star or whatever as a single. Now they wouldnt be forcing me to buy them but just the mere fact that they choose to do that I would disagree with.<< Yes, you might disagree with them but, ultimately, it is the artist who decides what to do not the audience. >>And of course xtc are artists and should be paid for what they do, but releasing a set of demos like Homegrown is similar to charging people to sit in rehearsals for a play or publishing the first draft of a novel complete with rewrites and editors notes.<< I don't know that I agree with that analogy popboy. If you're going to use the theater analogy, I'd say it's more like purchasing tickets to a try out of a play before it premieres. Again, don't know that I would agree with the writing analogy either. I'd compare it more to someone who has written a short story or short novel. They publish it and then discover that there's more to the story and end up publishing a full length novel. Regardless, I don't think that Partridge or Moulding needs our approval to put the stuff out. If there's a market then it's legit. >>I have not heard any of the Dave session work have any distinctive Dave sound on it. Andy's session work is much more distinct. Is Dave just a very competent session man? Are there any of Dave's session work that you could tell he was playing on without having been told or read in the album credits? And if this is true, how much is he really missed from XTC??<< Interesting comment. I can always tell Dave's guitar playing. He has a sound as distinct as Robert Fripp, Carl Perkins, George Harrison or Keith Richard (that is when he isn't cripping from Chuck Berry). The same applies to his keyboard work on most albums. As to other instruments, well, I can't say that I notice a distinctive sound to them because, quite simply, I haven't heard him play bass all that much. I still love XTC but the band's sound has changed since Dave left (the same was true when Barry Andrews left IMO). Wasp Star sounded stripped down. That's not a bad thing, but it lacked many of the qualities that made Skylarking, Big Express, English Settlement, etc. so memorable. Has it impacted the writing? Absolutely not. Some material may have been released because Dave wasn't a voting member of the band but that's O.K., too. from Chris Clee >>Out of curiosity why didn't you simply record the original tracks in the original order and leave out the extras.....lots cheaper methinks, i mean these days you can even cutomise your own cd's on your pc :)<< If Virgin hadn't gone back to remaster the CDs and improve the sound quality I would probably have done that. I do like Dunks comments the remasters. Virgin didn't do them the right way in the first place because it's product. They knew fans would buy it and pony up yet again when they did the job the right way. I'm happy that they didn't just repackage the stuff this time. Ted said >>The big surprise so far as been that inside my Go 2, I discovered a sleeve for Go+. Anybody know why the sleeve's in the package but the songs aren't?<< Yes because they are faithfully reproducing the packaging based on the original LP's and the first pressing had the Go+ sleeve and record as part of the package. I imagine that Virgin will also remaster Explode Together (which has those tracks). A pity since it would have made far better sense to put them on as bonus tracks.
------------------------------ Date: Sat, 9 Jun 2001 19:46:34 -0400 From: Rodney <rodneye@inspiracy.com> Subject: Re: Enough about Homespun/Homegrown! Message-ID: <a05001907b748642b2069@[207.88.126.133]> "Richard" <rjpa1@home.com> mentioned: >track "Two Minutes of Silence" which was just that - BTW, did they get BMI >royalties everytime a radio station went "dead air" for two minutes?). I seem to recall that when someone covered "Two Minutes Silence" in the 1980s the band was required to pay royalties, so I'd say "yes."
------------------------------ Date: Sun, 10 Jun 2001 10:57:56 -0700 From: "thomas vest" <tvtwo@hotmail.com> Subject: places to buy reissues in the usa + other things... Message-ID: <F304WLjLHvtxZrClAAS00010bb9@hotmail.com> hello fellow chalkhillians my first post here after months of reading these wonderful tidbits of information. someone asked where in the usa can you purchase the reissues. i have found two places (three actually- but more on that one at the end). if you rely on the internet for purchasing, then go to www.duffelbag.com-- they are very good as i have purchased from them in the past with great success. they have two listings for all the new reissues (from different distributors i assume) and the prices are $19.98 and 21.98 respectively. scott @ duffelbag says there is no difference in the actual discs themselves so you can save a few dollars. now if you live in the san francisco bay area, then you can visit a fabulous store called amoeba. they are selling all the reissues for $19.98 as well. i have been very lucky in the last six months or so there. i have found gems like: "the loving" 3 " cd single, crown shaped "king for a day" cd single, "towers of london 45 with the plastic slip cover and the free extra single & finally the 9 track promo only cd from the "transistor blast box set" titled "what do you call that noise?". metal and xtc? yes, lump me in that lot as well. i cut my teeth on classic rock and then metal in the 80's. Judas Priest is still one of my favorite bands. and whoever talked about tool in the last issue is quite right about how good they are and the new album is. well, that's all for now. i did not want this to approach novel length. take care. thom tvtwo@hotmail.com -- There was a time I was lost in the dark, I ran a race I didn't know where to start, Now I've changed my ways, Seeing better days, I'm turning my world upside down... The world is full of angry young men
------------------------------ Date: Sun, 10 Jun 2001 11:18:54 -0700 (PDT) From: Tyler Hewitt <tahewitt@yahoo.com> Subject: Homegrown-n-stuff Message-ID: <20010610181854.97008.qmail@web14201.mail.yahoo.com> Richard Pedreitti-Allen's comments about Homegrown said exactly what I was about to in a long post. Thanks, Richard-you've saved me some time! That said, I must comment on one thing: "It is not a Lennon rebellion against the suckers who would buy any and every noise he ever made (i.e., the "Life With The Lions" LP which included the track "Two Minutes of Silence" which was just that - ..." Seems like I've spent a lifetime defending Yoko to anyone who'll listen, and to tell the truth I'm too busy right now to do the same once again (consider yourselves lucky!) Let me just say that those Lennon/Ono records are more accurately viewed as audio conceptual art than they are music. Also, John Cage did basically the same thing decades earlier with his piece '4:33'. For those of you who don't know, '4:33' is a work for solo piano in which the pianist sits quietly without playing anything for the duration of the piece. Discussions on the importance of this sort of thing will have to wait for another time. I have a 2 cd compilation John cage tribute that has a recording of Frank Zappa playing '4:33'. It is, as you should have figured, 4:33 of silence. Did Zappa actually 'play' Cage's work for the cd? Probably. Finishing on an unrelated note, I was in Tower Records on Clark St. In Chicago last night. They're selling the new lp cover remestered XTC cd's for $29.99 each! OUCH! I paid $13.81 each ordering from HMV.com! While I was there I bought Kirsty Maccoll's Tropical Brainstorm, which has finally been released domestically (with different cover, three bonus tracks and a video). This is good one, folks. Get it!
------------------------------ Date: Sun, 10 Jun 2001 17:41:12 EDT From: OMBEAN1@aol.com Subject: Another connection Message-ID: <d1.7da73a5.28554378@aol.com> yo. While watching The History Channel the other day, I stumbled upon this piece of info : Jason & The Argonauts crossed the Black Sea during their adventure. Has this already been brought up? Can we make a new album to album connection? Am I stretching it? Am I asking way too many questions? AC = Anal Cleanser. Duh. I turn 40 on the 13th. Death, where is thy sting? Roger
------------------------------ Date: Sun, 10 Jun 2001 15:27:55 -0700 From: "Drude" <the-drude@home.com> Subject: Re: alt.fan.andy-j-partridge Message-ID: <003201c0f1fc$989f4040$6ec94518@gv.shawcable.net> Okay, so...that IS a stupid name for an XTC newsgroup, however, one of the best ways for alt.music.xtc to get off the ground, is that XTC fans start posting some messages on the newsgroups...wherever they may land (alt.music.80s, what-have-you...). So, considering no one one is currently using the alt.fan.andy-j-partridge group...let's take it over and start some conversation threads, that way, when alt.music.xtc gets going, we will already have some built-in posters. Also, it will help my (our) case when re-proposing alt.music.xtc to the alt.config guys.... So, why don't y'all drop by alt.fan.andy-j-partridge and we'll chat... Drude
------------------------------ Date: Mon, 11 Jun 2001 11:04:01 -0500 From: "Richard" <rjpa1@home.com> Subject: Song sequencing Message-ID: <011801c0f290$21e14e00$02081fac@verisity.com> MDM stated: "When an artist makes an album, part of the artistry is deciding on flow and sequencing. It is not to be hacked up by people outside the creativity circle." While this is true in SOME cases and is certainly true for XTC now, it quite likely wasn't the case when XTC worked for Virgin and isn't true for most signed artists. Though the artists may have some input, the decision is more of a "group" decision involving the artist, the producer, the A/R person or the marketing arm of the record company and sometimes even opinion polls. They look for the strong "opener" and places to bury "filler" tracks. They think about "taking the listener back down" by placing a ballad after a strong peak. They consider the "flow" of the record. This cannot always be objectively accomplished by the artist as they often have emotional ties to certain tracks. Remember, Todd R had the entire song sequence for Skylarking done before XTC showed up to record. Todd is the person who made it into a concept album. And as "Song Stories" states Andy "...was not in a strong bargaining position with Virgin and meekly accepted his fate." So, XTC had nothing to do with the sequencing of Skylarking. Concept albums are typically the exception but there have plenty of those in which producers or record company goons have omitted or changed tracks (e.g., Skylarking replacing Mermaid Smiled with Dear God, Pink Floyd's The Wall omitting Bring The Boys Back Home and When The Tiger Broke Free, Jellyfish's Spilt Milk omitting Ignorance Is Bliss). This can be for marketing reasons (Skylarking), length/manufacturing reasons (The Wall), continuity reasons (Spilt Milk) or a combination of those reasons (English Settlement going from two discs to one). Regretfully, the Picasso analogy doesn't quite work because Pablo wasn't _commisioned_ to do the work (which, in a way, musical artists are). If he was, the client does have the right to specify what they want and how they want it to look, if only in a general sense (i.e., you ask Picasso to paint a "Picasso" not a "Matisse"). In other words, if I was paying someone to paint my portrait, I'd like my nose to be where my nose is. I have my CDs in a 400 CD changer and the 300+ CDs in the "Pop/Rock" category are played at random, so unless I take a CD in the car with me (which means I have the ability to skip tracks at my fingertips), I never hear two songs from the same CD in a row. That pretty much negates any sense of continuity of any CD. It's like a radio station that only plays the songs you like with the only hint of discontinuity being crossfades and distractingly odd sequences like Pink Thing followed by Fiddle About followed by Flakes followed by Step Right Up followed by... Cheers, Richard
------------------------------ Date: Mon, 11 Jun 2001 12:44:26 -0700 From: "Drude" <the-drude@home.com> Subject: alt.music.xtc... on the air? Message-ID: <001601c0f2ae$ec0118a0$6ec94518@gv.shawcable.net> Hey guys... I have sent my control message for alt.music.xtc, and, if I'm lucky, it should be out there within a few days. Soooo...anyone who's interested can drop by and join the discussion. If, in a few days, you don't see it, contact your news administrator (at your ISP) by phone or e-mail, and ask if they will carry it. Alt.fan.andy-j-partridge does exist, but the messages keep disappearing, so it's not very useful. Also, by having XTC in the group's name, hopefully we can draw in some 'lurkers' out there and have a successful newsgroup! If there are any problems/issues, I will post to Chalkhills (which I hope everyone will continue to use) with the info... Drude
------------------------------ Date: Mon, 11 Jun 2001 18:45:00 EDT From: Hbsherwood@aol.com Subject: Is it good for baseball? Is it good for the Jews? Message-ID: <73.e880197.2856a3ec@aol.com> Tinkie-Winkies: Haven't heard enough of you yet getting all squishy and gooey over the impending July 10th release of David Yazbek's "Damascus." Let's correct that soon, OK? I fully intended to get up to New York to catch the prerelease party this weekend, but She Who Must Be reminded me that our precious son was born that very day lo those eight years ago, and that it is traditional in our simple Armenian culture for the father to stay home from Rock-n-Roll Road Trips on the day of his son's birth. Thus do we preserve our national identity in these times of invidious cultural homogenization. It Takes a Greenwich Village to Raise a Child... For those of you who are too clueless even to live, Yazbek is the only male musician Andy Partridge has ever offered to marry. Well, no, I guess that's not *quite* true, but a rather large amount of saliva has been exchanged since Yazbek produced the "Testimonial Dinner" album a few years ago, which, even though it wasn't *nearly* as good as Richard Pedretti-Allen's pro-am versions, did have its moments. (Ruben Blades in da house!) Yazbek was recently jobbed for a Tony for his songwriting for the Broadway adaptation of "The Full Monty," but for my money his albums "Tock" and "The Laughing Man" are the smartest, finest, stickiest, slap-nutsiest Musician's Music around. Partridge played on both, natch. ---- >From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au> >Subject: AC? > >Twice I have now encountered this term, "AC". Chris Vreeland, in 'Hills ># 34, has "the AC on full blast" in his car. > >On Soulwax's magnificent "Much Against Everyone's Advice" album (cheers >Dom!), there is a hidden track at the start of the CD, in which reference >is also made to driving along with the AC on. > >Please sate this old-fashioned luddite's curiosity, and pray tell: what >is an AC? O woe is me that it ever came to this. That we should even be *discussing* this in a public forum is tragic enough, but when a buddy like Chris Vreeland comes out of the closet to reveal the true depths of his depravity--and then acts like it's completely natural!--I can no longer remain silent. As has been said many times before, this is a Family Digest, and frankly I'm a little disturbed that John Relph even let this topic come to light. AC, Paul my friend, stands for Alternating Current. There is a trend among "young" "hip" "people" (especially those living in our larger cities, where they are exposed daily to the hideous turpitudes of the demimondaines of the East Village and the Castro (and there, I fear, lies the Relph connection!) that the ordinary pleasures of the flesh that our good Lord bestowed upon us -- pleasures that make it such a joy to fulfill His commandment to Go Forth and Multiply with a single member of the opposite sex with whom we are bound for life unless we're some sort of weirdo -- are simply not good enough. These callous sophisticates, these _soi-disant_ "Bohemians," seek ever more outre "kicks," ever more exotic stimulations of their pleasure centers, in order to fulfill their horribly jaded sensual palates. One day it might be Jell-O high colonics, the next Tantric Nipple-Stim; today it's angel-hair pasta and latex, tomorrow absinthe and crinoline. These cosmopolites flit from depravity to dissolution, hummingbirds of vice, looking neither right nor left in their mindless drive for ever more exquisite pleasures. The idea, Paul, is that the combination of the automobile's physical speed and AC electricity applied to the sensitive areas of the body will, when experienced simultaneously, produce a thunderous reaction that will heighten the climactic event beyond anything ever experienced. Sales of high-powered batteries, surgical paddles, and Monster Cable have skyrocketed in red-light districts the world over, auto-parts shops now feature adult book booths, and sex shops carry mufflers and soldering kits. Only the other day, one of these exquisites passed me at 120 MPH on the Dulles Toll Road, Daft Punk rattling the windows, electrical smoke wafting out his ears and haloing around his head, a look of monstrous satiety on his face. His personalized license plate? "SHOCK THE MONKEY." I pulled over prudently, got out the Nokia, and called 911. The only kind of love these depraved bastards understand is stone-tough love. Chris Vreeland, get help. ----- >From: "Steve Oleson" <Steve.Oleson@oag.state.tx.us> >Subject: Blighty? Blimey! > >I hadn't heard the nickname "Ol' Blighty" before the last couple of >Chalkhills. What does it mean? (Boy, they're just crawling out of the woodwork today! What have I got, a sign around my neck, "Will bullshit you for food!"?) Like so much of the best spurious etymology, "Blighty" is a term that dates back to the Black Death, where it first appeared in a children's rhyme that is still sung to this day: Highty-tighty Christ Almighty Who the hell are we? Zim-zam, God DAMN We're the fighting Sixth Marines! "Highty-tighty" refers to the first signs of the disease, which tended to be rather highty, and yet tighty. "Christ Almighty" is an invocation of a local deity who was commonly worshiped at the time, but who was, it turned out, not much of a one for intervening in medical matters. "Zim-Zam" was a Babylonian magic incantation, which in those days of Galenic medicine and burnt sulfur was about the best weapon you had against the Plague. The rest of the rhyme is fairly self-explanatory. So there, Steve, is the origin of the term! Don't listen to any of those silly folk etymologies you're likely to hear from so-called "scholars" and self-appointed "experts"; remember, the best source of information is *always* gonna be some asshole on the Internet! (Try http://youth.net/memories/1999/0089.html for some supporting evidence.) ----- >From: "Robert C. Miner" <minerr@bc.edu> >Subject: Trip to Swindon >Philosophers have an >unfortunate (but often deserved) reputation of using the tools of logic >and argumentation as a stick with which to beat their interlocutors. If I didn't have enormous regard for the Department of Philosophy of Boston College (Go Eagles! Ever to Excel!) I would have to point out that this hasty generalization, based on a sample too small to support an inductive generalization about a population, is an inductive fallacy. The Department of Philosophy at Boston College may indeed be packed to the rafters with captious blowhards, and yet it may be that, right across town, their colleagues at Tufts are shining beacons of receptiveness, sensitivity, and warm _Gemuetlichkeit,_ just the sort of fellows you'd want to share a tipple with down at the Twig and Berries on a Saturday night, with a hey-nonny-nonny and a hot-cha-cha. The sample used in your inductive inference may very well be relevantly different from the philosophico-egghead population as a whole, you see, and here is where I believe you commit your bloomer. The proof of the foregoing is left as an exercise for the student. Harrison "There are stranger things, Horatio..." Sherwood
------------------------------ Date: Tue, 12 Jun 2001 11:11:28 +0100 From: "Mick Casey" <mick@dijit.net> Subject: Instant Dave Message-ID: <003101c0f328$21106d60$1401a8c0@dnm72> Dear Hillers Seesaw@aol.com wrote, asking... >>...Are there any of Dave's session work that you could tell he was playing on without having been told or read in the album credits? And if this is true, how much is he really missed from XTC??? Don't get me wrong, I have always loved Dave's playing and was sad to see him leave XTC, but how much of what he did was just playing what Andy told him to play? After all, look at how close a lot of the demos these past years have been to the finished product. Your opinions please... Dave has appeared on a couple of LPs by a guy called Louis Philippe. On both of them Dave is instantly recognisable, whether doing the jangly 12-string thang, the intricate twiddly-solo thang or the full-on Dukes-ey psychedelia thang. Also, if you get hold of the Partridge-penned Cathy Dennis track 'Am I The Kinda Girl', that's Dave's patented 'Merely A Man' slashing that drive the song forward. Again, instantly recognisable. I, for one, miss him greatly. -- Mick Casey casey@dircon.co.uk
------------------------------
Date: Tue, 12 Jun 2001 08:41:55 EDT
From: Sedivo@aol.com
Subject: Re: Take me back to dear 'ol Blighty!
Message-ID: <d7.7b84193.28576813@aol.com>
Hello Old Chaps,
Steve Oleson enquired as to the meaning of the expression
"'ol Blighty". Well my dear American fellow it is an old army term derived
from a Hindi word. The Hindi version is bilati meaning country. The
soldiers in the British Empire days of India used to use it to refer to the
homeland, namely England. This is best illustrated if you can get hold of a
copy of The Smiths The Queen Is Dead - the intro to the album has a song
with the words:
Take me back to dear 'ol Blighty,
Put me on the train to London town,
Take me anywhere, drop me anywhere,
Liverpool, Leeds or Birmingham,
'Cos I don't care!
Thanks very much to my dear American cousin for initiating the digging out of
said album - haven't heard it for ages! Very good, too. OK must go, it's time
for tea and scones and I must iron the cat, the neighbours are coming over
for sherry at 8!
Toodle Pip!!!
Seds
P.S. By the way, I'm Greek Cypriot!!!!! Can't really stand the English!!
------------------------------ Date: Tue, 12 Jun 2001 08:21:40 -0400 From: "Joe Funk" <twosheds@mindspring.com> Subject: In The Deep Message-ID: <007601c0f33a$3cce9c40$a92df7a5@funklt> >From Chris V. >Let me explain. >I haven't really taken the dive off into the deep end of Xtc >completism, until now. Chris, I think you took the deep dive into completism long ago.... How many of the singles do you have? Bootlegs? E-bay purchases? Jo "and a recording of Andy cleaning the gutters?" mama Check out our new tune: "Chase" at: http://www.angelfire.com/art/twosheds/twosheds.html
------------------------------ Date: Tue, 12 Jun 2001 15:22:31 +0200 From: art et affiche <art.affiche@wanadoo.fr> Subject: Guitarist chord? What? Message-ID: <3B261793.CAB8A20C@wanadoo.fr> Bonjour Chalkhills! First, great thanks to Richard Pedretti-Allen for closing (in my opinion) the debate about Homespun/homegrown. Have fun, Mr Relph. In his last post, Seesaw asks: "I have not heard any of the Dave session work have any distinctive Dave sound on it. Andy's session work is much more distinct. Is Dave just a very competent session man?" Yes he is. I've always felt that DG was an excellent guitarist and arranger, a good technician, good in music theory. This is the 1st difference with AP or CM: they are self-made musicians, they never took lessons. But the main difference is that AP or CM are composers, creative people, and DG a performer. A gifted one, but "just" a performer playing his ex-bandmates compositions. I remember an interview of DG talking about Andy as songwriter. He found his incredible skill of writing such good music and great lyrics quite "unfair", because coming from a man who doesn't even know all the chords he's playing. And I remember a quote, where Andy was complaining about the fact that people who covered "Respectable street" always play one particular chord wrongly (I think it's the 2d), and Gregory commented: "Of course, because it's not a guitarist chord", and Partridge replied "Sure, it's a Partridge's chord". Well, am I wrong or you can feel a light taste of bitterness and jealousy here? Andy doesn't seem to consider himself as a GUITARIST, and it's a good thing according to me: I know some musicians, some who have studied music theory, some not. And in the 1st category, (I'm sorry if you belong to this one), a few are -sometimes- boring. They consider themselves better than the self-taught ones. They are a little square with their formal conception of music. And the comment of DG about Andy's chords is very significant... So, yes, I find Andy's session work more personal and distinct, because he plays like Andy! Ok, DG is able to play like- I don't know, Knopfler, or Page, or Hendrix, or Clapton, can do arpeggios and stuff. Ok, some solos are wonderfull (remember That wave), but the most inventive, surprising and evocative things on XTC's music, the sharpest, wildest riffs come from Andy's guitar, even if the chords changes seems strange to some conventional ears. But it's just my opinion. I can't play guitar and hardly 4 notes on my Fender bass guitar, so... Dear Angie : "(...) so far as I can tell, you have to get in line! I think it starts in St. Andrews.<G>." What!!! Are you telling me that I'm not the ONLY one to fantasize about a pink thing or a brown guitar? Oh no, my world is crumbling away... Let's make a club, and become manipulated members. "(...) Partridge Manipulation?! Sounds like a massage technique, a band, or an ornithological crime. (...)" YES YES! Sounds like a mad scientist experience ! A worldwide conspiracy from a foolish brainiac, who wants to make partridges in thousands leave their meadow and fly to buy records in shopping malls! Or a mysterious spell from the pre-Celtic era, engraved in a rock and buried under the Uffington Horse! But it's time to take my valium, and get back to work. Marie "But then the other girl tells me to get in line, and I'm the last to know" Omnibus.
------------------------------ Date: Tue, 12 Jun 2001 07:55:50 -0700 (PDT) From: Ira Lieman <ilieman@yahoo.com> Subject: Da boob toob Message-ID: <20010612145550.36015.qmail@web11201.mail.yahoo.com> Hillbillies, As noted in today's (6-12-01) Variety: >NEW YORK (Variety) - Cartoon Network is growing up. >The cable channel plans to air ``Adult Swim,'' a new block of animated >programming aimed at young adults, specifically viewers aged 18 to 34, >beginning in September. The programming block, which will air on Sunday >and Thursday nights from 10 p.m. to 1 a.m. (ET/PT), will include five >new series and fresh episodes of the cult talk show ``Space Ghost Coast >to Coast.'' Maybe we'll get to see the Andy Partridge episode? I must admit I'm not in tune to Space Ghost, but I'd definitely set my VCR to tape Andy on it. In other news, I still don't have Homegrown...but being a torture victim of Dot-Com Central, I also have no cash at the moment. <sigh> Although I do still have my job. Who approved John Relph's vacation? I sure as hell didn't. :) Have a great time, John. -ira "minimum wage....heeyah!" lieman
------------------------------ Date: Tue, 12 Jun 2001 08:06:48 -0700 (PDT) From: Cathryn Myers <cathrynmyers@yahoo.com> Subject: Express Yourself Message-ID: <20010612150648.6247.qmail@web3904.mail.yahoo.com> If I had one of those New York City apartments with long hallways and speakers in every room, I might have enough space to properly express my joy at the remastering of the Big Express. Only then could I have the proper location for the happy dance that would occur in this magnificent apartment on the day the Japanese remaster of the Big Express arrived in the mail. Arms flailing, lungs wailing, I would dance a jig of joy up and down the hallway with speakers blaring in every room, the comfortingly wonderful, much misunderstood opus that is, The Big Express. This is the album (perhaps besides the first two albums and Drums and Wires) that was most in need of remastering. It is like night and day folks. If I had been stoned during my first listen, I surely would have cried tears of joy. I think it starts to happen around the end of "You're the Wish You Are I Had": a feeling that all is right with the world. As I sink back into Colin's jazzy scat "Sun" offering, the hiss of the cymbals, clear for the first time, I grow almost depressed with the realization that all this will be ending soon. The journey is so quick and intense, and regrettably brief. With these remasters comes The Big Express I always knew was possible, and, finally, is. Remarkably, although I had been in my apartment listening to a cd, suddenly, with the intro to Train Running Low, I am on a platform, engines racing, the sound of the steam sounding like singing, enjoying the evolution of random sound into music. The clarity of the production is truly "transforming". Things you notice right off the bat: Wake Up - Sounds amazing. No more blurry "cello mixed with Moog synthesizer" - like sound that closes out the song underneath the chorus of Wake Up. All of you pretty girls: Sounds much cleaner. It had a crisp sound to begin with, but now it is rounded out by a much clearer bass track and what sounds like tin can drumming. The cracking sound of the whips on Shake Your Donkey Up rumbles the song into gear and there is no letting up from there. Those of you Chalksters who cannot find it within yourselves to "get" this song need to keep listening and learn to get a "groove" on. The syncopated bass line of this song gets my toes tapping every time. I especially love that chorus that comes in at 2:45, just after the groovy Andy improv following the middle eight-"She really shake you donkey up-she really make you donkey up-she really shake you-..She really make you -.donkey-she really make you - donkey-.she really shake you (and then)-boom -pow pow-boom-. She Really shake you donkey up, She really make you donkey Up-She really shake you donkey up, quite a packet. Wow! Here are the problems: As much as I was looking forward to the return of the proper tracking order, I think there should have been an extended pause after This World Over and Small Town. I need a break to recover. I know it seems like a silence as the volume of This World decreases to almost a whisper at the song's close, but with the new clarity of the remasters, you can actually hear the boys until the very end. It's beautiful. That is why I believe Small Town really needs a moment of silence before it begins. The extra time is required to allow the listener to get into formation. I don't know about you, but this song almost requires me to get up and march around. I must confess that Small Town has occupied my "favorite song" position many times over the years. And as Pancho said in the last digest, the song just comes alive on the remaster. The album, overall, still sounds a bit brassy, but I believe that was part of the point. The volume of This World Over increases dramatically at around the 2:40 mark. It's almost a bit sloppy. I am tempted to declare that the bloody extra tracks should have been left off the remasters. Just put everything in a nice box for Fuzzy Warble already. But the "sound" of the guitars on Red Brick Dream is so convincing that to have orphaned them at the juncture where we can finally hear them seems unfair and foolish. Let 'em be. By the way, everyone in the states should take advantage of being able to order from Amazon.uk.co. They have all of the remasters for 9.35 GBP and the cd's only take a few days to arrive via Royal Air mail. Much better than the 30 dollars that they want for them at the local Virgin Mega Store. What a great time to be a XTC fan. (By the way is there are name for us?) Cathryn
------------------------------ End of Chalkhills Digest #7-36 ******************************
Go back to Volume 7.
12 June 2001 / Feedback