Chalkhills Digest Volume 6, Issue 175
Date: Wednesday, 28 June 2000
Chalkhills Digest, Volume 6, Number 175
Wednesday, 28 June 2000
Topics:
URGENT POST: Listening Party Announcement
Wasp Star
Q's "Best" 100
XTC newbie (be gentle)
Re: Dunks on American Entertainment
XTC song in new Farrely Bros. comedy
Radios In Motion
What TVT stands for, no kidding
XTC interview
Odd spot
(none)
Green Mountain High...er XTC?
XTC on BBC Radio today/tonight - how to listen online
Dutch charts week 24
offwhites
WS Production & Longest Word?
Administrivia:
I will be on vacation until July 11. Chalkhills will be off the air
until then. Enjoy your time off!
To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
<chalkhills-request@chalkhills.org> with the following command:
unsubscribe
For all other administrative issues, send a message to:
<chalkhills-request@chalkhills.org>
Please remember to send your Chalkhills postings to:
<chalkhills@chalkhills.org>
World Wide Web: <http://chalkhills.org/>
The views expressed herein are those of the individual authors.
Chalkhills is compiled with Digest 3.7b (John Relph <relph@tmbg.org>).
So we're working every hour that God made / So we can fly away.
---------------------------------------------------------------------- Date: Tue, 27 Jun 2000 12:18:27 -0700 (PDT) From: Molly Fanton <mfanton99@yahoo.com> Subject: URGENT POST: Listening Party Announcement Message-ID: <20000627191827.28334.qmail@web1304.mail.yahoo.com> Okay, I've decided to just continue with the listening parties with Drums and Wires. We can go back to Go2 another time. So just check out this site: http://www.angelfire.com/mn/mollyfa99/xtclisteningparty.html. I just hope this post posts before Saturday. :) The regulars who come should know the new time. Saturday afternoon at 2pm. This week I WILL be at my apartment in Buffalo, not my parents'. But on Saturday July 15th there won't be a listening party, because I'm going back to Wellsville for their Hot Air Balloon Rally. Maybe I'll even bring Apple Venus Vol. 1 and blast "The Last Balloon" when the last balloon goes up. :) Molly Molly's Pages: http://www.angelfire.com/mn/mollyfa99/index.html My Tribute to Talk Talk & .O.Rang: http://www.angelfire.com/mn/mollyfa99/talktalkorang.html
------------------------------ Date: Mon, 19 Jun 2000 10:32:21 +0100 (BST) From: Chris Clee <cmc@sanger.ac.uk> Subject: Wasp Star Message-ID: <Pine.OSF.4.21.0006191027220.21017-100000@piranha> Quite promising, but you can feel that Daves guitar is missing, like a jigsaw missing that last piece right in the middle. Glad the production was less obvious than AV1 (which i still find difficult to listen to all the way through ): Getting there but not quite back to english settlement or black sea in depth and sheer energy, chris TGCCATCGGATCTCCTGCCTAGAGGAG
------------------------------ Date: Sun, 18 Jun 2000 21:18:07 -0700 From: "John Keel" <jbkev1@ev1.net> Subject: Q's "Best" 100 Message-ID: <003f01bfd9a7$89417f00$26525d3f@sony.com> Hi kids, What the fuck is up with "Q" magazine putting out a list of the "100 Best British Albums" and NOT ONE XTC ALBUM IS ON THE LIST!!!!!! I'm a little behind in my digests, but has this been discussed? I'm am outraged. How the fuck could that be? Maybe this is the ravings of a hard-core fan, but I just can't fathom why or how XTC didn't make the list AT LEAST ONCE!!! You would think "Black Sea" or "English Settlement" would be two prime candidates, not to mention "Oranges & Lemons" or "Skylarking" or "Drums & Wires" BUT NOT ONE GODDAMN ONE OF THEIR ALBUMS WERE MENTIONED ANYWHERE (unless I missed it for which I apologize profusely). Now, I don't read "Q" so maybe they suck as a mag anyway, but I'm just completely dumbfounded. JESUS CHRIST "ERIC CLAPTON UNPLUGGED" IS EVEN ON THERE!!!!! I don't know what else to say. I'm going to fire off an ANGRY note to them as soon as I find their e-mail address which I forgot by the time I got home. Feel free to join me in making them aware of this blatant, inexcusable offense. On a happier note, a BIG thanks to Wes Long for making my very first XTC trade experience so memorable. I got some great audio which I had never heard before - even having been an XTC fan for 20 years - since I had never tapped into the whole demo/fan club/trade thing before. Has anyone else raved about "I Don't Wanna Be Here"? I am so in love with that song I can't stand it. It's so simple and straightforward and wonderful - IMHO. I've been playing it on my guitar non-stop for days (I'll try to send in tablature soon - the one I found on Chalkhills was way wrong unless it was a different recording than I have). Now that I've heard that and "Ship Trapped in the Ice" and "Prince of Orange" I so hope they end up recording them, although the demos stand on their own. Actually, since "ITMWML" is the first single off "WS", I always thought it was funny that how in "Song Stories", Neville Farmer had it listed in the "B-side" section calling it "one of Andy's clumsier-sounding songs". However, having heard the demo on the bonus CD-single, I would agree. The demo doesn't stand up nearly as much to me as "IDWBH" or "STITI". I'll even go out on a limb and say I would definitely prefer either one of those to "My Brown Guitar" or even "You and the Clouds . . .", even though they're both great songs. But, maybe that's just me. I'm heading to see Tyler Hewitt next for a possible trade, so get ready Tyler. I'm hooked! Thanks for listening!!!!!! John ********************************************* "I drank a rainbow, but I could not get me drunk. All I could get me was blue." Andy Partridge
------------------------------
Date: Sun, 18 Jun 2000 20:26:36 EDT
From: Wisemoon@aol.com
Subject: XTC newbie (be gentle)
Message-ID: <6b.5c579f2.267ec2bc@aol.com>
Greetings!
I think it's about time I introduce myself. Forgive me if this gets long.
My name is Alyssa. and I am 20 years old. I have been a silent observer for
quite some time on here simply because I have felt quite intimidated by all
your knowledge of XTC. You see I am new to XTC. Last summer I was
apprenticing with a house painter. and on our long drive out to some job we
were doing I heard Greenman for the first time on the radio.
I sat in awe listening, dangling my arm out the window in the Chicago heat.
The whole time I was thinking... "damn this sounds so pagan." And when it
ended the announcer said it was XTC doing a song about the ancient pagan
British fertility rites. And I about jumped out of my seat.
You see I am pagan. (for those of you who do not know about paganism it's an
earth based religion. Don't worry I don't worship Satan) anyway they had
captured so easily the essence of the religion. Joyful, earthy, and so
freespirited.
For the next two days I was glued to the radio hoping to hear it again.. it
just took root in my head and grew into an obsession and need.
Now I had never heard of XTC before in my life. I grew up on smashing
pumpkins, and even oasis, although my tastes range to Sarah brightman and
enya. And when I finally went and bought Apple Venus it was such a huge
relief to fill my ears constantly with the music I longed for. The rest of
the CD, the first time through was an "eh?" But as I have learned it takes a
few plays through to fall in love with XTC. and I did. I spent that summer
painting walls and tuning out with my head phones on to XTC. I joined this
group soon after wishing to learn more about this marvelous group, but I
hadn't gotten the hang of it when I first wrote and never even realized my
question was posted. so I have no idea if I got an answer or not. So I spent
all winter watching this post board, to frightened and ignorant to dare
comment. You all seem to have grown up to their music and know so much more
than i. and when Wasp star came out I was first in line to get it at the CD
store I go to. it took me two listens to fall in love all over again. I love
every song on that CD, and that has never happened with a CD and me before!
I guess I have one positive angel to this, you all have to wait for each new
album to come out. But I have a stretch of 20 years to make up. And all these
old albums you know by heart are new to me. today I just went out and bought
oranges and lemons (which I am listening to now) and Mummer.
I decided it was time to let you guys know that there is a young person out
there who is quickly becoming a giant fan of XTC. And although I know so
little, and I cannot relate to missing Dave, I want to learn as much as I
can.
So my XTC masters, take me under your wings and teach me the world of XTC...
! Show me the ways and the wonders, and I will promise to get as many of my
"younger" friends exposed to this incredible music!
Please e-mail me personally if you have any good web sites or info you think
would be good for me to know. I am an eager student :)
Thank you for listening to me babble there.. Hope to get to know you all
better now that I got the nerve to speak up :)
Warmest of smiles
Alyssa
------------------------------ Date: Mon, 19 Jun 2000 12:01:00 -0400 From: "Kulak, Matt (HT-EX)" <MKulak@GI.com> Subject: Re: Dunks on American Entertainment Message-ID: <89ADE0C79170D2119F3100805F19D19A04DCC1B0@xchsrv3.gic.gi.com> First, to comply with the obligatory "XTC content" rule: Let me just say to all of you that feel compelled to tell the rest of us how you could improve XTC's songs, production methods, track inclusions and orders, and other critical aspects of their craft: "give it a rest"!!!!! I understand that this is the type of venue for people to voice their opinions (no matter how presumptuous or ridiculous), and that the daily Chalkills would be fairly short without these same opinions, but for a fan-based publication, you folks do a lot of complaining! What do you say we have a prerequisite for these "backseat" musicians/producers that says they must first have published enough music to have developed a fan base like XTC, such that those fans participate in a daily e-letter like this one, and that we can all subscribe to so we can critique THEIR MUSIC! Let's see if these experts practice what they preach. To whomever suggested the term "smorgasbord" in referring to XTC's complete works: great observation!!!! I've liked every release from White Music to AV2. Do I like some songs better than others? Sure. Do I feel some of Colin's songs are better than others? Absolutely. I also think some of Andy's songs are better than others. But I fully appreciate the different "feels" of their writing. Almost every XTC song has something to offer: a really cool (usually wry) lyric, an awesome bass line, some sonic background noise, a great guitar riff (I love Andy's funky guitar lines in Brown Guitar), or both Andy and Colin's truly distinctive vocalizations. I don't know - maybe it's just me. Maybe you all have way too much time on your hands, such that you translate all the little thoughts inside your head into emails to Chalkhills???? I guess the attitude that comes through some time is - to put it bluntly - obnoxious. Andy and Colin are not perfect. I'm sure they would be the first to admit that. But music is an art, and is subject to many interpretations. Your interpretations are no better than mine or the next person's. So don't come off sounding like XTC was wrong and your suggestions are right. They made the choice they believed in - and as the artists - are solely entitled to. While you are all at it - any suggestions to fix up the painting "The Last Supper"??? I was thinking they need another Apostle in there. It just seems too damned asymmetric to me. And don't even get me started on those stupid Picassos! That woman only has half a fucking face! For God's sake, Pablo, at least finish your works before publishing them! And then there is the supposed literary master Ernest Hemingway: Can't you come up with some more complex sentences? Shit, I was writing like that in 6th grade . . . INTERMISSION: Sorry all, this is my first post ever, and it's turning out to be a lengthy venting! If you want to go hit the restrooms or grab a drink, you might want to go do that now. My second, and last topic (yes, you can all rest easy) is my reply to Duncan Kimball's meandering post on "moron musicals" Duncan says: >By contrast, let us consider the animated version of Aladdin -- exactly >the kind of trashy, one-dimensional, puerile, sanitised, Americanised >nonsense we have come to expect from The Great Entertainer. Yet another >product straight off the line, punched out to service a market that has >been programmed for generations to accept exactly this kind of drivel. I >don't deny their right to do it, but I reserve my right to think it >sucks. First of all, it's an American-made movie, so it's going to be fucking Americanized. When I see a French movie, do you think I see an American take on things? Or a British emphasis? Or maybe an Australian perspective? No, it's French, because it's a French movie. Same with Italian movies. Same with Dutch movies. If we Americans presumed to make foreign films based on cultures we do not inherently know, how do you think people like you would react? I can guess that you would be bitching and moaning that we have no right to make such a movie. >What's at the root of my dislike of musicals? It goes back to childhood I >suppose. I don't blame Julie. (I must say that I was very sad to hear of >her unfortunate voice mishap. No-one deserves that.) I do find 'Sound Of >Music' repugnant, but that's just me. Actually, I blame Disney. Having >grown up with Winnie The Pooh, "The Jungle Book" and "The Once and Future >King", I never really recovered from the disgust I experienced when >confronted by the Disneyfied "versions" of these marvellous works. This >was my first major exposure to that strange American impulse that sees >nothing wrong in putting a beautiful and special work through the >Cuisinart, and mincing a bunch of songs into the story simply in order to >make it digestable for The American Audience. I've never understood it >and I don't like it. It strikes me as a singularly crass form of cultural >imperialism. Anglophile? Hardly. I love a lot of things about >America. This just happens not to be one of them. Let me ask you something: What do most people think of when they think "Disney"? Children! These are fucking movies for children? Do you understand the concept of a target audience? Many of the kids watching these movies are from 2 to 6 years old! Do you have any kids? Did you ever see a child's eyes light up when they see Tigger come bouncing and singing across the screen? Or howl with delight when the genie in Aladdin does his goofy voices and changes shapes? Children love songs and singing. It keeps them attentive - and also allows them to sing along after they've watched the movie the first 25 or 30 times. And exactly how true to the initial stories do you think Disney can be and still have children be excited to watch? Of course the original works are boiled down into simpler stories and morals. But did you ever think of the benefit? That these children are becoming aware of sometimes brilliant works of art at an early age? How many children would even know of Pocahontas, or Mulan, or Aladdin were it not for Disney movies introducing them? >Where was I? Oh yes ... Whatever the merits (or otherwise) of having such >quintessentially English works boiled down into middle-brow, >middle-American pabulum, there remains the basic question that will >mystify me to my dying day: why WOULD anyone want to turn something as >magical as "The Jungle Book" into a lumpen American animated musical?? >What *is* this weird imperative that drives people to appropriate >something like "The Full Monty", which speaks so distinctively of another >culture, and turn it into what is -- for me -- the dramatic equivalent of >a Elvis portrait on a velvet cushion? Oh, please, "pabulum"???? Give me a fucking break. Do you really talk like this? How many times do you refer to your thesaurus in writing one of your entries? My word, how extremely supercilious of you! Again, when it comes to Disney movies, my answer is: kids! Now, are there some of those stereotypical, loud, obnoxious Americans over here who would take a foreign classic and without a hint of regret, churn out some pathetic, watered-down, sappy, Americanized version? Sure there are. And I'm not defending them. But I think Disney does a commendable job of taking the core stories from classics, and re-packaging them for their target audience. >The only answer apparent to me is that the makers of these entertainments >know that they stand to make a whole bunch of money selling this stuff to >audiences so thoroughly indoctrinated by commercial Yankee mass culture >that they: >A) can't tolerate any form of entertainment that isn't voiced with American >accents >B) can't endure any narrative that doesn't have a song -- or an >advertisement -- rammed into it every five minutes, and >C) can't comprehend anything doesn't have a happy ending, with the >obligatory scenes of people laughing and slapping each other on the back, >and/or saluting the flag. In short, you are very good at generalizations. Very very good. Damn good. Shit, you just summed up the entire entertainment history of a country that's been around for over 200 years, in one paragraph. Gosh, I wish I could just as carelessly sling stereotypes around as you obviously can. You've taken your dislike of one particular genre of American entertainment (musicals) and expanded that to slag the entire country's entertainment industry and people. I'm sure your opinions are totally justified, of course, since you make sure to point out your authority throughout your entry in your endearingly, portentous way (yes, I too can read a thesaurus, but of course, I had to run out to the nearest bookstore to get me one this morning, since us unsophisticated, hicks from America rarely use such a thing, what with our unability for learnin and stuff). And by the way, in my 33 years of life, I can't recall seeing any movie that included anyone saluting the flag. So the sample of American movies you are using to make these generalizations must be pretty slim indeed! Could it be you've been spending a little too much time watching American porn movies - and for your information, those are not flagpoles, and those young ladies certainly are not saluting. -matt
------------------------------
Date: Mon, 19 Jun 2000 13:11:31 EDT
From: "Mike Wood" <stupidlyhappy@hotmail.com>
Subject: XTC song in new Farrely Bros. comedy
Message-ID: <20000619171131.44678.qmail@hotmail.com>
Saturday night I caught an advance preview of the new Jim Carrey comedy "Me
Myself & Irene", a very forgettable film with little reason to recommend
(and I loved "Something About Mary").
Anyway, much to my surprise, "I'd Like That" is featured very prominantly
near the start of the film as Carrey rides his motorcycle into town.
Does anyone know about the kind of payout that the lads could possibly
receive having one of their songs used in a major motion picture? I know
nothing about song-royalties in the film industry (outside of the fact that
Huey Lewis got $300,000 for his song to be used in American Psycho, before
causing that huge stink about wanting it removed... I would hope that "I'd
Like That" is worth more than "Hip To Be Square", but who knows...)
~~ Mike Wood ~
-------------
"talking about music is like wanking about rain."
- Alex James
------------------------------ Date: Mon, 19 Jun 2000 21:17:38 -0400 (EDT) From: Radios In Motion <radiosinmotion@iwon.com> Subject: Radios In Motion Message-ID: <384420905.961463858942.JavaMail.root@web193-iw> I have been trying to think of a cool band name for over 10 years now and have always been unsuccessful in finding the ultimate band name. I have thought of some really cool names, but none that I have clicked with. Anyway, the other day I had the idea to just name my band (which now just includes myself playing guitar, a drum machine and beginning bass until I find other musicians who can see my brilliance). I figure, Radios In Motion is a damn good name, what do you all think? I know its not totally original, but I wanted a name to place on my music.
------------------------------ Date: Mon, 19 Jun 2000 23:22:56 -0700 (PDT) From: Ryan Anthony <hamsterranch@yahoo.com> Subject: What TVT stands for, no kidding Message-ID: <20000620062256.12621.qmail@web117.yahoomail.com> Andrew Lloyd Weber made me do it. Or was it Kenny G? Britney Spears, perhaps. I'm not sure which of Chalkhills' devils gets the blame. My crime of lust? I bought that second CD jukebox which, in a previous Digest, I admitted coveting and threatened to acquire. With room for 600 discs, the entire collection now makes the cut, with room to spare for *Apple Venus Vols. 3-100*. In you go, Residents and Klaatu! Have a seat, Shel Silverstein and Schoolly-D! Take those slots right there, Great Kat and Celestial Navigations! Make yourself comfortable, *Television's Greatest Hits*! Speaking of that TV theme song compilation: I don't know if it first appeared as a two-disc vinyl LP, but the version I have is a single CD copyrighted 1986 by an outfit called TeeVee Toons, Inc. The TVT logo looks awfully familiar ... where have I seen it before? Ah, there it is on the back of *Apple Venus* and *Wasp Star*. In case you were wondering what TVT stands for, and what its first release was, now you know. Also finding a home in the new jukebox's cavernous maw is *Stolar Tracks Vol. 1*, a compilation CD, released in 1992 to promote Stolichnaya vodka, which opens with "The Ballad of Peter Pumpkinhead." The blurb was written by a fan, or a copywriter talented enough to give that impression. Hoping I won't hear from the Stoli lawyers if I quote it in its entirety, here it is: "Truly one of new music's legendary bands, XTC gets better with age. *Nonsuch*, their 10th LP, is yet another unique masterpiece, a crafty combination of colorful, wise and pointed prose. `The Ballad of Peter Pumpkinhead,' the album's first single, is an anthemic fable about a popular martyr that shows Andy Partridge and XTC deftly balancing melody and message as only they can." Using my real name because all my pseudonyms (Yad S. "Loof" Lirpa, Alice Volat Propriis, Dustin Stax, Paige Turner, Sal Atticum, Lauren Leveut, F. Stop Fitzgerald, Lois Common Denominator, Polly Kay Verso, Gary Outrance, Iolanthe "Stan'back" Jones, and the Ol' Hamster Rancher) sound old and tired and I haven't coined any new ones in years, Ryan Anthony An independent Internet content provider
------------------------------ Date: Tue, 20 Jun 2000 10:39:42 +0200 From: Volker Dieling <volker.dieling@mail.uni-oldenburg.de> Subject: XTC interview Message-ID: <394F2DCE.898A4087@mail.uni-oldenburg.de> Organization: Universitaet Oldenburg Hi all, just wanted to inform you that there's gonna be an XTC interview/article in the next issue from the german mag "Keys", which is a magazine for keyboards and studio equipment. So I bet it's gonna be focussed on production details of Wasp Star. For all non-german Chalkhillians (means 99 % of you, haha) I'll put it in the archives. Check the website from mid of July on. And one word to all british football affiliates: Congratulations to Alan Shearer who finally kicked the totally disgraceful german team in the ass after 34 years of humiliating penalty shots. Football's coming home, I hope. Bye all. Lemoncurry residing in the Lemon Lounge at www.geocities.com/SouthBeach/9259 Send your spam to lemoncurry23@yahoo.com Save the Mudokons !
------------------------------ Date: Wed, 21 Jun 2000 10:38:37 +0930 From: "Van Abbe, Dominic" <dominic.vanabbe@au.faulding.com> Subject: Odd spot Message-ID: <45C458C0C9C7D2119F790000F87A42A4B00101@s-mulgrave6.faulding.com.au> Greetings all, If only DJ's this world over had a bit more imagination. I heard an "odd spot" yesterday, which would segue perfectly into an XtC track. We know by now that the Anglican Church has approved female priests. Well, apparently a male priest of a parish in Swindon, Wiltshire, England (a Peter somebody or other) is soon to undergo "the snip" to become a female (of sorts) priest. It has been run past his parishioners and has been given the green light. From there you've got the perfect segue into "Church of Women" by XtC, who, as we well know, are from none other than Swindon, Wiltshire, England!!! I'm fairly sure it was not the intent Partridge had when he wrote the song, but...... :-) Dom
------------------------------ Date: Tue, 20 Jun 2000 21:39:31 -0500 From: "David" <peeng1@email.msn.com> Subject: (none) Message-ID: <000b01bfdb29$f207c200$a83f243f@6914cqcqa015> Seventh Grade Says: 1. Hey, isn't Yazbek the chick from "Bay Watch"?. 2. I went and saw Journey once. The only thing I remember is Steve Perry pointing his ass at the crowd and saying "100% beef ". 3. I'm still waiting for the "Re-animator" musical. Date, mate, re-animate; la lala laaaaaa! 4. The words "luscious" and "delicious" make me nervous. 5. While listening to an XTC song, do you ever think: Hey! That song would have fit perfectly in that movie. For example: Mayor of Simpleton in Forrest Gump. 6. I worry about the Vikings. (The team, not the people.) I've got a hankerin" for some chocolate chip cookies, Mr. Martin 7.
------------------------------
Date: Tue, 20 Jun 2000 14:33:24 EDT
From: "Seth Frisby" <vagueyear@hotmail.com>
Subject: Green Mountain High...er XTC?
Message-ID: <20000620183324.19864.qmail@hotmail.com>
Hi ChalkFolks..
Been away from all things cyber related as i've moved to the country
permanently(Vermont)...and i've had no computer in my run down shack of a
house, plenty of dust though..My Wasp Star listening has petered off a bit
lately, not for any particular reason, just giving catchy as hell songs such
as Stupidly happy a rest from my poor wasted brain, and since I live in such
a small place I don't want Xtc's welcome to wear thin on my roomates. I
still can't decide whether SH or We're all light should be the singles,
though it looks as though Andy the master Architect wants to showcase the
juggernaut pop of Stupidly Happy and who can really argue with Andy? *(no
answers please)* see asterisks mean some variant of sarcasm, which kind is
up to you..(It's the middle of the post)
Got a cheap Gold edition of O&L through the evil ebay(my father is
addicted to buying Frisbee pie plates for some reason)...and am very happy
with it's sparkling sound...been listening to the new King Crimson and new
Belle and Sebastian and I like both of them more than I expected. The new KC
is a powerhouse with Adrian Belew really pulling his guitar weight. The new
FraKCtured and Lark's Tongue are the kind of beastly epic barnstormers only
KC and Fripp can do...B&S is a bit more diffuse and top heavy than some of
their earlier albums but still quite gorgeous..a couple of the songs could
have used less orchestral fiddle faddle but who am I to say ( just a nosy
fan with a opinion!)...well anyways to let everyone get back to their
normally scheduled Chalkhills i'll take my leave...
Seth "Beautiful Beastly Bearded" Frisby
p.s The Big Express is a surprisingly good album and so is Wasp Star..simple
as that..!
------------------------------ Date: Tue, 20 Jun 2000 08:20:21 -0700 From: Peter Fitzpatrick <peterfit@MICROSOFT.com> Subject: XTC on BBC Radio today/tonight - how to listen online Message-ID: <B9B4268C8F87D11195DC0000F840FABE12AF7696@DUB-MSG-02> http://www.bbc.co.uk/londonlive/entertainment/radio_pages/garycrowley.shtml I hope this is right... apparently Colin & Andy are appearing on Gary Crowley show tonight at 10:00pm GMT (that's Tuesday June 20th) there's a link to a live webfeed. http://www.bbc.co.uk/londonlive/live/fmv5.ram I'll try and get this on satellite if I can and will tape it. (I phoned Andy to see if I could get confirmation but he wasn't home) -Peter
------------------------------ Date: Wed, 21 Jun 2000 09:29:18 +0200 From: a.de.koning@bp.vnu.com Subject: Dutch charts week 24 Message-ID: <C1256905.002A3AF1.00@bpa.vnu.com> WS went up 1 place from 30 to 29 in it's third week in the 'scherpe kant van platenland'. It has dropped out of the Mania 30 of Kink-fm. I did see that ITMWML is on the playlist of the 'Mind the gap' program on Kink-fm (but I don't listen to the radio to check if it's true). And talking about ITMWML: yesterday it occurred to me that the guitar solo reminds me of 'Whiskey in the Jar' in the Thin Lizzy version. Anyone agree? Andre
------------------------------ Date: Tue, 20 Jun 2000 13:42:53 -0700 From: "Hiatt, Randy" <Randy.Hiatt@fsbti.com> Subject: offwhites Message-ID: <F34536084B78D311AF53009027B0D7EAE3D9CD@FSBEX01> I want to thank all you chalkwhites for your music recommendations over the years.... I will echo those who set me up... get all the Yazbek you can, if your ever in need of a new XtC fix (you poor, poor demo ingesters) Yazbek will help you through your hunger pains. Kevin Gilbert keeps suprizing me too, just got Shaming of the True, wow. If you read and enjoyed that music industry article by Holes queen orifice then this CD is a real kick (sadly but true). Randy (sans sans) Hiatt http://members.tripod.com/RandyHiatt/
------------------------------ Date: Wed, 21 Jun 2000 11:17:32 PDT From: "Ralph Simpson DeMarco" <sawpit@hotmail.com> Subject: WS Production & Longest Word? Message-ID: <20000621181732.66305.qmail@hotmail.com> Chalkers: OK some of you folks do not make any sense to me. Why compare later albums to early ones? They are so far removed in time, as to make it silly. Imagine if you compared Abbey Road to Rubber Soul and complained about how Come Together and You Never Give Me Your Money can't ever measure up to In My Life or I'm Looking Through You. So, compare Black Sea to Wasp Star, how does that enlighten us? If you had never heard of XTC and someone played WS, would you say "sounds good, but there's something missing"? I doubt it. If XTC still sounded like they did in 1980, you would all be complaining that the band hasn't grown up. XTC has not been a hard-rocking band since 1984. And to criticize slick production? (Since when have XTC ever been a low-fi band? Been listening to the demos too damn much?) So, the Beatles should never have been produced by George Martin because it made them too slick sounding? The Kinks were stuck with Shel Talmy who did a pretty crappy job in my estimation. They even had to sneak behind his back to re-record Dead End Street because Talmy couldn't be bothered to spend the little extra money to make Ray happy. In the end, when he heard the playback Talmy never even noticed the huge difference. Ray also self-produced Waterloo Sunset because it was so important for him to get it right. Can you imagine McCartney self-producing a single track on Rubber Soul because he didn't trust George Martin to treat it correctly? XTC has never had a career producer like Talking Heads had Brian Eno. But, I think they've had good instincts, and change has made for some amazing contrasts between albums. Andy is far from the studio wizard. But, he has learned from the best. Wasp Star proves that it all rubbed off. Perhaps you folks don't like the way a certain record was MIXED. That makes more sense to me. A bad mix (like The Smartest Monkees) can make or break a song. XTC sound great on Wasp Star. Do I miss Dave? Nope. ************************************************** The longest word in the English language? I think it is... "antidisestablishmentarianism" an.ti.dis.es.tab.lish.men.tar.i.an.ism, n. opposition to the withdrawal of state support or recognition from an established church, esp. the Anglican Church in 19th-century England. [ANTI- + DISESTABLISHMENT + -ARIAN + -ISM] *************************************************** "I must say that I find television very educational. The minute somebody turns it on, I go to the library and read a book." Groucho Marx
------------------------------ End of Chalkhills Digest #6-175 *******************************
Go back to Volume 6.
28 June 2000 / Feedback