Errors-To: owner-chalkhills@els.sgi.com
Reply-To: chalkhills@els.sgi.com
Sender: owner-chalkhills@els.sgi.com
Precedence: bulk
From: owner-chalkhills@els.sgi.com
To: chalkhills@els.sgi.com
Subject: Chalkhills Digest #7-36


          Chalkhills Digest, Volume 7, Number 36

                  Tuesday, 12 June 2001

Topics:

           XTC featured on Virgin Radio website
                           Amen
                            AC
         The REAL reason to get Homegrown/spun +
                  Re: Daves contribution
                     BS Outer Sleeves
                     Re: AC/ budgets
Home grown can somethings be tastier than store bought...and reissues
           Re: Enough about Homespun/Homegrown!
   places to buy reissues in the usa + other things...
                    Homegrown-n-stuff
                    Another connection
               Re: alt.fan.andy-j-partridge
                     Song sequencing
               alt.music.xtc... on the air?
    Is it good for baseball? Is it good for the Jews?
                       Instant Dave
          Re: Take me back to dear 'ol Blighty!
                       In The Deep
                  Guitarist chord? What?
                       Da boob toob
                     Express Yourself

Administrivia:

    To UNSUBSCRIBE from the Chalkhills mailing list, send a message to
    <chalkhills-request@chalkhills.org> with the following command:

        unsubscribe

    For all other administrative issues, send a message to:

        <chalkhills-request@chalkhills.org>

    Please remember to send your Chalkhills postings to:

        <chalkhills@chalkhills.org>

    World Wide Web: <http://chalkhills.org/>

    The views expressed herein are those of the individual authors.

    Chalkhills is compiled with Digest 3.7c (John Relph <relph@tmbg.org>).

I make decisions / Influence people.

----------------------------------------------------------------------

Date: Sat, 9 Jun 2001 15:24:20 +0100
From: Ian Sutton <SuttonI.london@arriva.co.uk>
Subject: XTC featured on Virgin Radio website
Message-ID: <4BC0278484CBD4118B9700E018C3490602C410@ARLN_03>

Check out the Virgin Radio website for a chance to win one of 5 signed
sets of the remastered albums.  You can also download three of the
videos, and Chalkhills gets first mention in their list of XTC links.

I am not connected with Virgin at all and think I've just severely
jeopardised my chance of winning the albums!!

Ian

------------------------------

Date: Sat, 09 Jun 2001 13:58:12 -0400
From: Molly <mollyfa0000@worldnet.att.net>
Subject: Amen
Message-ID: <3B2263B3.5603ADD3@worldnet.att.net>
Organization: AT&T Worldnet

Richard wrote:
<<If you don't want to buy Homespun, Homegrown or whatever, you are
not one of the people it was made for and that's okay too.  It does
not diminish your value as a fan.  You don't have to be a completist
to appreciate XTC.>>

Amen, Richard.  I don't like it when people think that they're bigger
fans of a certain group/artist just because they own everything from
that artist/group.  I LOVE XTC, but I don't have all their stuff, and I
don't think I want all their stuff.  But that doesn't make me a lesser
fan for that.  I am planning on getting Homegrown, because I already
have Homespun, and I like the demos, because I like how some of the
songs before they get the final touches.  But that's all I'm getting
into.  I'm not going to get the remastered albums, unless they're
released in the US.  I'm not spending money for Japanese imports.  It's
too expensive IMHO.

Molly

------------------------------

Date: Sat, 09 Jun 2001 13:59:04 -0400
From: "Garret Harkawik" <funktaisia@hotmail.com>
Subject: AC
Message-ID: <F125ksQ6KLV47ozI9Wb00007e91@hotmail.com>

>Please sate this old-fashioned luddite's curiosity, and pray tell:
>what is an AC?

Ac is air conditioning.

------------------------------

Date: Sat, 9 Jun 2001 15:22:00 -0500
From: "d-erelict" <magmound@texas.net>
Subject: The REAL reason to get Homegrown/spun +
Message-ID: <001101c0f121$d71c8840$036163d1@derek>

To me, the REAL value of getting Homespun and Homegrown isn't neccessarily
to "look into" the process, or to have multiple versions of songs, but I
TRULY believe that many of these demo versions are FAR superior to thier
over-produced studio counter-parts... when compiling a 1cd version of Apple
Venus, I used the demo version Greenman, because I really feel they sucked
the life out of the song in the studio...

As for Homegrown, I can actually listen to Stupidly Happy and Wounded Horse,
now... and I still prefer the demo version of Church of Women... what they
should have done, in hindsight, is just booked some studio time to "touch
up" these demos... why try and get some snooty studio musician to try and
recapture the feel of your sample?
I'm not so big on the really rough, Andy-talking-in-the-middle demos... but
the "finished" multitrack recordings have a spark that the million-dollar
studio versions simply lack, to my ears...

> From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au>
> Subject: AC?
> Please sate this old-fashioned luddite's curiosity, and pray tell: what is
> an AC?

Air Conditioner... or, Air Cooler, you could say...

> From: "Steve Oleson" <Steve.Oleson@oag.state.tx.us>
> Subject: Blighty? Blimey!
> I hadn't heard the nickname "Ol' Blighty" before the last couple of
> Chalkhills.  What does it mean?
> - The Texian

It's just an old slang term for Britain, if I'm not mistaken...

d-erek

------------------------------

Date: Sat, 9 Jun 2001 14:23:26 -0700 (PDT)
From: Jeff Eby <jeffaeb@yahoo.com>
Subject: Re: Daves contribution
Message-ID: <20010609212326.89899.qmail@web11602.mail.yahoo.com>

"Seesaw" wrote

>I have had to ask myself a tough question
though. I have not heard any of the Dave session work
have any distinctive Dave sound on it. Andy's session
work is much more distinct. Is Dave just a
very competent session man? Are there any of Dave's
session work that you could tell he was playing on
without having been told or read in the album
credits? And if this is true, how much is he really
missed from XTC???
Don't get me wrong, I have always loved Dave's playing
and was sad to see him leave
XTC, but how much of what he did was just playing what
Andy told him to play?<

I think Dave's influence was subtle but important.  As
a musician quite adept at arranging and scoring
orchestration he filled a role that Andy and Colin
couldn't.  According to the song stories postscript
when Andy did the orchestration for A.V. on computer
it left Dave with very little to contribute.

Personally I think Dave's greatest XTC moment is his
orchestration on 1000 umbrellas.  It is probably my
favorite XTC song of all time and was pretty much only
saved from disposal because of Dave's brilliant string
arrangement.  The song really reflects the miserable
feelings in the lyrics but at the same time the song
as a whole always cheers me up.

------------------------------

Date: Sun, 10 Jun 2001 00:38:56 +0200
From: "Mark Strijbos" <mark.strijbos@hccnet.nl>
Subject: BS Outer Sleeves
Message-ID: <200106092227.AAA17764@smtp.hccnet.nl>

Dear Chalkers,

Sorry, i've been asleep for a while, i'll try to catch up on the current
events & threads ASAP

> Was the black plastic bag on British copies? I've
> heard of it, but have only seen the green paper one.

the black plastic outer bag was isued only in Canada, all other
countries used some form of green bag or outer sleeve. the sort of
paper and the actual shade of green used varied wildly from country
to country.

yours in xtc,

Mark Strijbos

------------------------------

Date: Sun, 10 Jun 2001 00:24:13 +0100
From: "Pledge" <Pledge7@btinternet.com>
Subject: Re: AC/ budgets
Message-ID: <000901c0f13b$4c13bba0$6a9f7ad5@oemcomputer>

Chris Clee commented:

From: Chris Clee <cmc@sanger.ac.uk>
>
>mister/miss pledge
>
>Out of curiosity why didn't you simply record the original tracks in
>the original order and leave out the extras.....lots cheaper methinks,
>i mean these days you can even cutomise your own cd's on your pc :)
>
>still....i have a tight budget
>
>TGCCATCGGATCTCCTGCCTAGAGGAG

Firstly, it's mr thanks. Secondly, i couldn't be bothered and my cd writer
is not hooked up on my current pc. Thirdly, I'm also on a tight budget. Much
tighter than I realised when I bought those CDs on the soon to be cut up
plastic :-(. Fourthly the only letters I can think to add are GFC.

Paul Culname asked:

From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au>
Subject: AC?
>
>Twice I have now encountered this term, "AC".   Chris Vreeland, in 'Hills
># 34, has "the AC on full blast" in his car.
>
>On Soulwax's magnificent "Much Against Everyone's Advice" album (cheers
>Dom!), there is a hidden track at the start of the CD, in which reference
>is also made to driving along with the AC on.
>
>Please sate this old-fashioned luddite's curiosity, and pray tell: what is
>an AC?

Paul, my guess is that AC relates to air conditioning. You know the thing
that means you don't need to lose half your car stereo's volume out of the
window on a hot day.

Pledge

PS Sorry for using my nickname on here. I was given it 18 or so years ago
and there are still too many people I meet that would never know me by my
real name. I've become so used to the name Pledge that it seemed the obvious
choice for an email address. I just didn't fancy being
Paul_Rodgers43982@someinternetprovider.com when I could get pledge7.

------------------------------

Date: Sat, 9 Jun 2001 19:33:06 EDT
From: WTDK@aol.com
Subject: Home grown can somethings be tastier than store bought...and
Message-ID: <72.b78ec00.28540c32@aol.com>

reissues
>From popboy:
>>In other words I would find it equally strange if xtc released every song
from Wasp Star or whatever as a single. Now they wouldnt be forcing me to
buy them but just the mere fact that they choose to do that I would disagree
with.<<

Yes, you might disagree with them but, ultimately, it is the artist who
decides what to do not the audience.

>>And of course xtc are artists and should be paid for what they do, but
releasing a set of demos like Homegrown is similar to charging people to sit
in rehearsals for a play or publishing the first draft of a novel complete
with rewrites and editors notes.<<

I don't know that I agree with that analogy popboy. If you're going to use
the theater analogy, I'd say it's more like purchasing tickets to a try out
of a play before it premieres.

Again, don't know that I would agree with the writing analogy either. I'd
compare it more to someone who has written a short story or short novel. They
publish it and then discover that there's more to the story and end up
publishing a full length novel. Regardless, I don't think that Partridge or
Moulding needs our approval to put the stuff out. If there's a market then
it's legit.

>>I have not heard any of the Dave session work have any distinctive
Dave sound on it. Andy's session work is much more distinct. Is Dave just a
very competent session man? Are there any of Dave's session work that you
could tell he was playing on without having been told or read in the album
credits? And if this is true, how much is he really missed from XTC??<<

Interesting comment. I can always tell Dave's guitar playing. He has a sound
as distinct as Robert Fripp, Carl Perkins, George Harrison or Keith Richard
(that is when he isn't cripping from Chuck Berry). The same applies to his
keyboard work on most albums. As to other instruments, well, I can't say that
I notice a distinctive sound to them because, quite simply, I haven't heard
him play bass all that much.

I still love XTC but the band's sound has changed since Dave left (the same
was true when Barry Andrews left IMO). Wasp Star sounded stripped down.
That's not a bad thing, but it lacked many of the qualities that made
Skylarking, Big Express, English Settlement, etc. so memorable. Has it
impacted the writing? Absolutely not. Some material may have been released
because Dave wasn't a voting member of the band but that's O.K., too.

from Chris Clee
>>Out of curiosity why didn't you simply record the original tracks in
the original order and leave out the extras.....lots cheaper methinks,
i mean these days you can even cutomise your own cd's on your pc :)<<

If Virgin hadn't gone back to remaster the CDs and improve the sound quality
I would probably have done that. I do like Dunks comments the remasters.
Virgin didn't do them the right way in the first place because it's product.
They knew fans would buy it and pony up yet again when they did the job the
right way. I'm happy that they didn't just repackage the stuff this time.

Ted said >>The big surprise so far as been that inside my Go 2, I
discovered a sleeve for Go+.

Anybody know why the sleeve's in the package but the songs aren't?<<

Yes because they are faithfully reproducing the packaging based on the
original LP's and the first pressing had the Go+ sleeve and record as part of
the package. I imagine that Virgin will also remaster Explode Together (which
has those tracks). A pity since it would have made far better sense to put
them on as bonus tracks.

------------------------------

Date: Sat, 9 Jun 2001 19:46:34 -0400
From: Rodney <rodneye@inspiracy.com>
Subject: Re: Enough about Homespun/Homegrown!
Message-ID: <a05001907b748642b2069@[207.88.126.133]>

"Richard" <rjpa1@home.com> mentioned:

>track "Two Minutes of Silence" which was just that - BTW, did they get BMI
>royalties everytime a radio station went "dead air" for two minutes?).

I seem to recall that when someone covered "Two Minutes Silence" in
the 1980s the band was required to pay royalties, so I'd say "yes."

------------------------------

Date: Sun, 10 Jun 2001 10:57:56 -0700
From: "thomas vest" <tvtwo@hotmail.com>
Subject: places to buy reissues in the usa + other things...
Message-ID: <F304WLjLHvtxZrClAAS00010bb9@hotmail.com>

hello fellow chalkhillians

my first post here after months of reading these wonderful tidbits of
information.

someone asked where in the usa can you purchase the reissues.  i have found
two places (three actually- but more on that one at the end).  if you rely
on the internet for purchasing, then go to www.duffelbag.com-- they are very
good as i have purchased from them in the past with great success.  they
have two listings for all the new reissues (from different distributors i
assume) and the prices are $19.98 and 21.98 respectively.  scott @ duffelbag
says there is no difference in the actual discs themselves so you can save a
few dollars.  now if you live in the san francisco bay area, then you can
visit a fabulous store called amoeba.  they are selling all the reissues for
$19.98 as well.  i have been very lucky in the last six months or so there.
i have found gems like:  "the loving" 3 " cd single, crown shaped "king for
a day" cd single, "towers of london 45 with the plastic slip cover and the
free extra single & finally the 9 track promo only cd from the "transistor
blast box set" titled "what do you call that noise?".

metal and xtc?  yes, lump me in that lot as well.  i cut my teeth on classic
rock and then metal in the 80's.  Judas Priest is still one of my favorite
bands.  and whoever talked about tool in the last issue is quite right about
how good they are and the new album is.

well, that's all for now.  i did not want this to approach novel length.
take care.

thom

tvtwo@hotmail.com

--
There was a time I was lost in the dark, I ran a race I didn't know where to
start, Now I've changed my ways, Seeing better days, I'm turning my world
upside down...

The world is full of angry young men

------------------------------

Date: Sun, 10 Jun 2001 11:18:54 -0700 (PDT)
From: Tyler Hewitt <tahewitt@yahoo.com>
Subject: Homegrown-n-stuff
Message-ID: <20010610181854.97008.qmail@web14201.mail.yahoo.com>

Richard Pedreitti-Allen's comments about Homegrown
said exactly what I was about to in a long post.
Thanks, Richard-you've saved me some time!

That said, I must comment on one thing:

"It is not a Lennon rebellion against the suckers who
would buy any and every noise he ever made (i.e., the
"Life With The Lions" LP which included the
track "Two Minutes of Silence" which was just that -
..."

Seems like I've spent a lifetime defending Yoko to
anyone who'll listen, and to tell the truth I'm too
busy right now to do the same once again (consider
yourselves lucky!)
Let me just say that those Lennon/Ono records are more
accurately viewed as audio conceptual art than they
are music. Also, John Cage did basically the same
thing decades earlier with his piece '4:33'. For those
of you who don't know, '4:33' is a work for solo piano
in which the pianist sits quietly without playing
anything for the duration of the piece. Discussions on
the importance of this sort of thing will have to wait
for another time.
I have a 2 cd compilation John cage tribute that has a
recording of Frank Zappa playing '4:33'. It is, as you
should have figured, 4:33 of silence. Did Zappa
actually 'play' Cage's work for the cd? Probably.

Finishing on an unrelated note, I was in Tower Records
on Clark St. In Chicago last night. They're selling
the new lp cover remestered XTC cd's for $29.99 each!
OUCH! I paid $13.81 each ordering from HMV.com!

While I was there I bought Kirsty Maccoll's Tropical
Brainstorm, which has finally been released
domestically (with different cover, three bonus tracks
and a video). This is  good one, folks. Get it!

------------------------------

Date: Sun, 10 Jun 2001 17:41:12 EDT
From: OMBEAN1@aol.com
Subject: Another connection
Message-ID: <d1.7da73a5.28554378@aol.com>

yo.
 While watching The History Channel the other day, I stumbled upon this piece
of info :  Jason &  The Argonauts crossed the Black Sea during their
adventure. Has this already been brought up? Can we make a new album to album
connection? Am I stretching it? Am I asking way too many questions?

   AC =  Anal Cleanser. Duh.

 I turn 40 on the 13th.  Death, where is thy sting?        Roger

------------------------------

Date: Sun, 10 Jun 2001 15:27:55 -0700
From: "Drude" <the-drude@home.com>
Subject: Re: alt.fan.andy-j-partridge
Message-ID: <003201c0f1fc$989f4040$6ec94518@gv.shawcable.net>

Okay, so...that IS a stupid name for an XTC newsgroup, however, one of the
best ways for alt.music.xtc to get off the ground, is that XTC fans start
posting some messages on the newsgroups...wherever they may land
(alt.music.80s, what-have-you...).

So, considering no one one is currently using the alt.fan.andy-j-partridge
group...let's take it over and start some conversation threads, that way,
when alt.music.xtc gets going, we will already have some built-in posters.
Also, it will help my (our) case when re-proposing alt.music.xtc to the
alt.config guys....

So, why don't y'all drop by alt.fan.andy-j-partridge and we'll chat...

Drude

------------------------------

Date: Mon, 11 Jun 2001 11:04:01 -0500
From: "Richard" <rjpa1@home.com>
Subject: Song sequencing
Message-ID: <011801c0f290$21e14e00$02081fac@verisity.com>

MDM stated:

"When an artist makes an album, part of the artistry is deciding on flow and
sequencing.  It is not to be hacked up by people outside the creativity
circle."

While this is true in SOME cases and is certainly true for XTC now, it quite
likely wasn't the case when XTC worked for Virgin and isn't true for most
signed artists.

Though the artists may have some input, the decision is more of a "group"
decision involving the artist, the producer, the A/R person or the marketing
arm of the record company and sometimes even opinion polls.  They look for
the strong "opener" and places to bury "filler" tracks.  They think about
"taking the listener back down" by placing a ballad after a strong peak.
They consider the "flow" of the record.  This cannot always be objectively
accomplished by the artist as they often have emotional ties to certain
tracks.

Remember, Todd R had the entire song sequence for Skylarking done before XTC
showed up to record.  Todd is the person who made it into a concept album.
And as "Song Stories" states Andy "...was not in a strong bargaining
position with Virgin and meekly accepted his fate." So, XTC had nothing to
do with the sequencing of Skylarking.

Concept albums are typically the exception but there have plenty of those in
which producers or record company goons have omitted or changed tracks
(e.g., Skylarking replacing Mermaid Smiled with Dear God, Pink Floyd's The
Wall omitting Bring The Boys Back Home and When The Tiger Broke Free,
Jellyfish's Spilt Milk omitting Ignorance Is Bliss). This can be for
marketing reasons (Skylarking), length/manufacturing reasons (The Wall),
continuity reasons (Spilt Milk) or a combination of those reasons (English
Settlement going from two discs to one).

Regretfully, the Picasso analogy doesn't quite work because Pablo wasn't
_commisioned_ to do the work (which, in a way, musical artists are).  If he
was, the client does have the right to specify what they want and how they
want it to look, if only in a general sense (i.e., you ask Picasso to paint
a "Picasso" not a "Matisse").  In other words, if I was paying someone to
paint my portrait, I'd like my nose to be where my nose is.

I have my CDs in a 400 CD changer and the 300+ CDs in the "Pop/Rock"
category are played at random, so unless I take a CD in the car with me
(which means I have the ability to skip tracks at my fingertips), I never
hear two songs from the same CD in a row.  That pretty much negates any
sense of continuity of any CD.  It's like a radio station that only plays
the songs you like with the only hint of discontinuity being crossfades and
distractingly odd sequences like Pink Thing followed by Fiddle About
followed by Flakes followed by Step Right Up followed by...

Cheers,
Richard

------------------------------

Date: Mon, 11 Jun 2001 12:44:26 -0700
From: "Drude" <the-drude@home.com>
Subject: alt.music.xtc... on the air?
Message-ID: <001601c0f2ae$ec0118a0$6ec94518@gv.shawcable.net>

Hey guys...

I have sent my control message for alt.music.xtc, and, if I'm lucky, it
should be out there within a few days.  Soooo...anyone who's interested can
drop by and join the discussion.

If, in a few days, you don't see it, contact your news administrator (at
your ISP) by phone or e-mail, and ask if they will carry it.

Alt.fan.andy-j-partridge does exist, but the messages keep disappearing, so
it's not very useful.  Also, by having XTC in the group's name, hopefully we
can draw in some 'lurkers' out there and have a successful newsgroup!

If there are any problems/issues, I will post to Chalkhills (which I hope
everyone will continue to use) with the info...

Drude

------------------------------

Date: Mon, 11 Jun 2001 18:45:00 EDT
From: Hbsherwood@aol.com
Subject: Is it good for baseball? Is it good for the Jews?
Message-ID: <73.e880197.2856a3ec@aol.com>

Tinkie-Winkies:

Haven't heard enough of you yet getting all squishy and gooey over the
impending July 10th release of David Yazbek's "Damascus." Let's correct that
soon, OK? I fully intended to get up to New York to catch the prerelease
party this weekend, but She Who Must Be reminded me that our precious son was
born that very day lo those eight years ago, and that it is traditional in
our simple Armenian culture for the father to stay home from Rock-n-Roll Road
Trips on the day of his son's birth. Thus do we preserve our national
identity in these times of invidious cultural homogenization. It Takes a
Greenwich Village to Raise a Child...

For those of you who are too clueless even to live, Yazbek is the only male
musician Andy Partridge has ever offered to marry.

Well, no, I guess that's not *quite* true, but a rather large amount of
saliva has been exchanged since Yazbek produced the "Testimonial Dinner"
album a few years ago, which, even though it wasn't *nearly* as good as
Richard Pedretti-Allen's pro-am versions, did have its moments. (Ruben Blades
in da house!)

Yazbek was recently jobbed for a Tony for his songwriting for the Broadway
adaptation of "The Full Monty," but for my money his albums "Tock" and "The
Laughing Man" are the smartest, finest, stickiest, slap-nutsiest Musician's
Music around. Partridge played on both, natch.

----

>From: "Culnane, Paul" <Paul.Culnane@dcita.gov.au>
>Subject: AC?
>
>Twice I have now encountered this term, "AC". Chris Vreeland, in 'Hills
># 34, has "the AC on full blast" in his car.
>
>On Soulwax's magnificent "Much Against Everyone's Advice" album (cheers
>Dom!), there is a hidden track at the start of the CD, in which reference
>is also made to driving along with the AC on.
>
>Please sate this old-fashioned luddite's curiosity, and pray tell: what
>is an AC?

O woe is me that it ever came to this.

That we should even be *discussing* this in a public forum is tragic enough,
but when a buddy like Chris Vreeland comes out of the closet to reveal the
true depths of his depravity--and then acts like it's completely natural!--I
can no longer remain silent. As has been said many times before, this is a
Family Digest, and frankly I'm a little disturbed that John Relph even let
this topic come to light.

AC, Paul my friend, stands for Alternating Current.

There is a trend among "young" "hip" "people" (especially those living in our
larger cities, where they are exposed daily to the hideous turpitudes of the
demimondaines of the East Village and the Castro (and there, I fear, lies the
Relph connection!) that the ordinary pleasures of the flesh that our good
Lord bestowed upon us -- pleasures that make it such a joy to fulfill His
commandment to Go Forth and Multiply with a single member of the opposite sex
with whom we are bound for life unless we're some sort of weirdo -- are
simply not good enough.

These callous sophisticates, these _soi-disant_ "Bohemians," seek ever more
outre "kicks," ever more exotic stimulations of their pleasure centers, in
order to fulfill their horribly jaded sensual palates. One day it might be
Jell-O high colonics, the next Tantric Nipple-Stim; today it's angel-hair
pasta and latex, tomorrow absinthe and crinoline. These cosmopolites flit
from depravity to dissolution, hummingbirds of vice, looking neither right
nor left in their mindless drive for ever more exquisite pleasures.

The idea, Paul, is that the combination of the automobile's physical speed
and AC electricity applied to the sensitive areas of the body will, when
experienced simultaneously, produce a thunderous reaction that will heighten
the climactic event beyond anything ever experienced. Sales of high-powered
batteries, surgical paddles, and Monster Cable have skyrocketed in red-light
districts the world over, auto-parts shops now feature adult book booths, and
sex shops carry mufflers and soldering kits. Only the other day, one of these
exquisites passed me at 120 MPH on the Dulles Toll Road, Daft Punk rattling
the windows, electrical smoke wafting out his ears and haloing around his
head, a look of monstrous satiety on his face. His personalized license
plate? "SHOCK THE MONKEY."

I pulled over prudently, got out the Nokia, and called 911. The only kind of
love these depraved bastards understand is stone-tough love.

Chris Vreeland, get help.

-----

>From: "Steve Oleson" <Steve.Oleson@oag.state.tx.us>
>Subject: Blighty? Blimey!
>
>I hadn't heard the nickname "Ol' Blighty" before the last couple of
>Chalkhills.  What does it mean?

(Boy, they're just crawling out of the woodwork today! What have I got, a
sign around my neck, "Will bullshit you for food!"?)

Like so much of the best spurious etymology, "Blighty" is a term that dates
back to the Black Death, where it first appeared in a children's rhyme that
is still sung to this day:

  Highty-tighty
  Christ Almighty
  Who the hell are we?
  Zim-zam, God DAMN
  We're the fighting Sixth Marines!

"Highty-tighty" refers to the first signs of the disease, which tended to be
rather highty, and yet tighty. "Christ Almighty" is an invocation of a local
deity who was commonly worshiped at the time, but who was, it turned out, not
much of a one for intervening in medical matters. "Zim-Zam" was a Babylonian
magic incantation, which in those days of Galenic medicine and burnt sulfur
was about the best weapon you had against the Plague. The rest of the rhyme
is fairly self-explanatory.

So there, Steve, is the origin of the term! Don't listen to any of those
silly folk etymologies you're likely to hear from so-called "scholars" and
self-appointed "experts"; remember, the best source of information is
*always* gonna be some asshole on the Internet!

(Try http://youth.net/memories/1999/0089.html for some supporting evidence.)

-----

>From: "Robert C. Miner" <minerr@bc.edu>
>Subject: Trip to Swindon

>Philosophers have an
>unfortunate (but often deserved) reputation of using the tools of logic
>and argumentation as a stick with which to beat their interlocutors.

If I didn't have enormous regard for the Department of Philosophy of Boston
College (Go Eagles! Ever to Excel!) I would have to point out that this hasty
generalization, based on a sample too small to support an inductive
generalization about a population, is an inductive fallacy. The Department of
Philosophy at Boston College may indeed be packed to the rafters with
captious blowhards, and yet it may be that, right across town, their
colleagues at Tufts are shining beacons of receptiveness, sensitivity, and
warm _Gemuetlichkeit,_ just the sort of fellows you'd want to share a tipple
with down at the Twig and Berries on a Saturday night, with a hey-nonny-nonny
and a hot-cha-cha. The sample used in your inductive inference may very well
be relevantly different from the philosophico-egghead population as a whole,
you see, and here is where I believe you commit your bloomer.

The proof of the foregoing is left as an exercise for the student.

Harrison "There are stranger things, Horatio..." Sherwood

------------------------------

Date: Tue, 12 Jun 2001 11:11:28 +0100
From: "Mick Casey" <mick@dijit.net>
Subject: Instant Dave
Message-ID: <003101c0f328$21106d60$1401a8c0@dnm72>

Dear Hillers

Seesaw@aol.com wrote, asking...

>>...Are there any of Dave's session work that you could tell he was
playing on without having been told or read in the album credits? And
if this is true, how much is he really missed from XTC??? Don't get me
wrong, I have always loved Dave's playing and was sad to see him leave
XTC, but how much of what he did was just playing what Andy told him
to play?  After all, look at how close a lot of the demos these past
years have been to the finished product. Your opinions please...

Dave has appeared on a couple of LPs by a guy called Louis
Philippe. On both of them Dave is instantly recognisable, whether
doing the jangly 12-string thang, the intricate twiddly-solo thang or
the full-on Dukes-ey psychedelia thang.

Also, if you get hold of the Partridge-penned Cathy Dennis track 'Am I
The Kinda Girl', that's Dave's patented 'Merely A Man' slashing that
drive the song forward. Again, instantly recognisable.

I, for one, miss him greatly.

--
Mick Casey
casey@dircon.co.uk

------------------------------

Date: Tue, 12 Jun 2001 08:41:55 EDT
From: Sedivo@aol.com
Subject: Re: Take me back to dear 'ol Blighty!
Message-ID: <d7.7b84193.28576813@aol.com>

Hello Old Chaps,
                Steve Oleson enquired as to the meaning of the expression
"'ol Blighty". Well my dear American fellow it is an old army term derived
from a Hindi word. The Hindi version is bilati meaning country. The
soldiers in the British Empire days of India used to use it to refer to the
homeland, namely England. This is best illustrated if you can get hold of a
copy of The Smiths The Queen Is Dead - the intro to the album has a song
with the words:

            Take me back to dear 'ol Blighty,
            Put me on the train to London town,
            Take me anywhere, drop me anywhere,
            Liverpool, Leeds or Birmingham,
            'Cos I don't care!

Thanks very much to my dear American cousin for initiating the digging out of
said album - haven't heard it for ages! Very good, too. OK must go, it's time
for tea and scones and I must iron the cat, the neighbours are coming over
for sherry at 8!

                                Toodle Pip!!!
                                            Seds
P.S.  By the way, I'm Greek Cypriot!!!!! Can't really stand the English!!

------------------------------

Date: Tue, 12 Jun 2001 08:21:40 -0400
From: "Joe Funk" <twosheds@mindspring.com>
Subject: In The Deep
Message-ID: <007601c0f33a$3cce9c40$a92df7a5@funklt>

>From Chris V.

>Let me explain.
>I haven't really taken the dive off into the deep end of Xtc
>completism, until now.

Chris,
I think you took the deep dive into completism long ago....

How many of the singles do you have?
Bootlegs?
E-bay purchases?

Jo "and a recording of Andy cleaning the gutters?" mama

Check out our new tune: "Chase" at:
http://www.angelfire.com/art/twosheds/twosheds.html

------------------------------

Date: Tue, 12 Jun 2001 15:22:31 +0200
From: art et affiche <art.affiche@wanadoo.fr>
Subject: Guitarist chord? What?
Message-ID: <3B261793.CAB8A20C@wanadoo.fr>

Bonjour Chalkhills!

First, great thanks to Richard Pedretti-Allen for closing (in my opinion)
the debate about Homespun/homegrown.

Have fun, Mr Relph.

In his last post, Seesaw asks: "I have not heard any of the Dave session
work have any distinctive Dave sound on it. Andy's session work is much
more distinct. Is Dave just a very competent session man?"

Yes he is. I've always felt that DG was an excellent guitarist and
arranger, a good technician, good in music theory. This is the 1st
difference with AP or CM: they are self-made musicians, they never took
lessons.

But the main difference is that AP or CM are composers, creative people,
and DG a performer. A gifted one, but "just" a performer playing his
ex-bandmates compositions.

I remember an interview of DG talking about Andy as songwriter. He found
his incredible skill of writing such good music and great lyrics quite
"unfair", because coming from a man who doesn't even know all the
chords he's playing. And I remember a quote, where Andy was complaining
about the fact that people who covered "Respectable street" always play
one particular chord wrongly (I think it's the 2d), and Gregory
commented: "Of course, because it's not a guitarist chord", and
Partridge replied "Sure, it's a Partridge's chord".

Well, am I wrong or you can feel a light taste of bitterness and jealousy
here?

Andy doesn't seem to consider himself as a GUITARIST, and it's a
good thing according to me: I know some musicians, some who have studied
music theory, some not. And in the 1st category, (I'm sorry if you
belong to this one), a few are -sometimes- boring. They consider
themselves better than the self-taught ones. They are a little square with
their formal conception of music. And the comment of DG about Andy's
chords is very significant...

So, yes, I find Andy's session work more personal and distinct, because
he plays like Andy! Ok, DG is able to play like- I don't know,
Knopfler, or Page, or Hendrix, or Clapton, can do arpeggios and stuff. Ok,
some solos are wonderfull (remember That wave), but the most inventive,
surprising and evocative things on XTC's music, the sharpest, wildest
riffs come from Andy's guitar, even if the chords changes seems strange
to some conventional ears.

But it's just my opinion. I can't play guitar and hardly 4 notes on my
Fender bass guitar, so...

Dear Angie :
"(...) so far as I can tell,  you have to get in line! I think it starts
in St. Andrews.<G>."

What!!! Are you telling me that I'm not the ONLY one to fantasize about
a pink thing or a brown guitar? Oh no, my world is crumbling away... Let's
make a club, and become manipulated members.

"(...) Partridge Manipulation?! Sounds like a massage technique, a band,
or an ornithological crime. (...)"

YES YES! Sounds like a mad scientist experience ! A worldwide conspiracy
from a foolish brainiac, who wants to make partridges in thousands leave
their meadow and fly to buy records in shopping malls! Or a mysterious
spell from the pre-Celtic era, engraved in a rock and buried under the
Uffington Horse!

But it's time to take my valium, and get back to work.

Marie "But then the other girl tells me to get in line, and I'm the last
to know" Omnibus.

------------------------------

Date: Tue, 12 Jun 2001 07:55:50 -0700 (PDT)
From: Ira Lieman <ilieman@yahoo.com>
Subject: Da boob toob
Message-ID: <20010612145550.36015.qmail@web11201.mail.yahoo.com>

Hillbillies,

As noted in today's (6-12-01) Variety:

>NEW YORK (Variety) - Cartoon Network is growing up.
>The cable channel plans to air ``Adult Swim,'' a new block of animated
>programming aimed at young adults, specifically viewers aged 18 to 34,
>beginning in September.  The programming block, which will air on Sunday
>and Thursday nights from 10 p.m.  to 1 a.m. (ET/PT), will include five
>new series and fresh episodes of the cult talk show ``Space Ghost Coast
>to Coast.''

Maybe we'll get to see the Andy Partridge episode? I must admit I'm not in
tune to Space Ghost, but I'd definitely set my VCR to tape Andy on it.

In other news, I still don't have Homegrown...but being a torture victim
of Dot-Com Central, I also have no cash at the moment. <sigh> Although I
do still have my job.

Who approved John Relph's vacation? I sure as hell didn't. :) Have a great
time, John.

-ira "minimum wage....heeyah!" lieman

------------------------------

Date: Tue, 12 Jun 2001 08:06:48 -0700 (PDT)
From: Cathryn Myers <cathrynmyers@yahoo.com>
Subject: Express Yourself
Message-ID: <20010612150648.6247.qmail@web3904.mail.yahoo.com>

If I had one of those New York City apartments with long hallways and
speakers in every room, I might have enough space to properly express
my joy at the remastering of the Big Express.  Only then could I have
the proper location for the happy dance that would occur in this
magnificent apartment on the day the Japanese remaster of the Big
Express arrived in the mail.  Arms flailing, lungs wailing, I would
dance a jig of joy up and down the hallway with speakers blaring in
every room, the comfortingly wonderful, much misunderstood opus that
is, The Big Express.

This is the album (perhaps besides the first two albums and Drums and
Wires) that was most in need of remastering.  It is like night and day
folks.  If I had been stoned during my first listen, I surely would
have cried tears of joy.

I think it starts to happen around the end of "You're the Wish You Are
I Had": a feeling that all is right with the world.  As I sink back
into Colin's jazzy scat "Sun" offering, the hiss of the cymbals, clear
for the first time, I grow almost depressed with the realization that
all this will be ending soon.  The journey is so quick and intense, and
regrettably brief.  With these remasters comes The Big Express I always
knew was possible, and, finally, is.

Remarkably, although I had been in my apartment listening to a cd,
suddenly, with the intro to Train Running Low, I am on a platform,
engines racing, the sound of the steam sounding like singing, enjoying
the evolution of random sound into music.  The clarity of the
production is truly "transforming".

Things you notice right off the bat:

Wake Up  - Sounds amazing.  No more blurry "cello mixed with Moog
synthesizer" - like sound that closes out the song underneath the
chorus of Wake Up.

All of you pretty girls:  Sounds much cleaner.  It had a crisp sound to
begin with, but now it is rounded out by a much clearer bass track and
what sounds like tin can drumming.

The cracking sound of the whips on Shake Your Donkey Up rumbles the
song into gear and there is no letting up from there.  Those of you
Chalksters who cannot find it within yourselves to "get" this song need
to keep listening and learn to get a "groove" on.  The syncopated bass
line of this song gets my toes tapping every time.  I especially love
that chorus that comes in at 2:45, just after the groovy Andy improv
following the middle eight-"She really shake you donkey up-she really
make you donkey up-she really shake you-..She really make you
-.donkey-she really make you - donkey-.she really shake you  (and
then)-boom -pow pow-boom-.  She Really shake you donkey up, She really
make you donkey Up-She really shake you donkey up, quite a packet.
Wow!

Here are the problems:
As much as I was looking forward to the return of the proper tracking
order, I think there should have been an extended pause after This
World Over and Small Town.  I need a break to recover.  I know it seems
like a silence as the volume of This World decreases to almost a
whisper at the song's close, but with the new clarity of the remasters,
you can actually hear the boys until the very end.  It's beautiful.
That is why I believe Small Town really needs a moment of silence
before it begins.  The extra time is required to allow the listener to
get into formation.  I don't know about you, but this song almost
requires me to get up and march around.  I must confess that Small Town
has occupied my "favorite song" position many times over the years.
And as Pancho said in the last digest, the song just comes alive on the
remaster.

The album, overall, still sounds a bit brassy, but I believe that was
part of the point.

The volume of This World Over increases dramatically at around the 2:40
mark.  It's almost a bit sloppy.

I am tempted to declare that the bloody extra tracks should have been
left off the remasters.  Just put everything in a nice box for Fuzzy
Warble already.  But the "sound" of the guitars on Red Brick Dream is
so convincing that to have orphaned them at the juncture where we can
finally hear them seems unfair and foolish.  Let 'em be.

By the way, everyone in the states should take advantage of being able
to order from Amazon.uk.co.  They have all of the remasters for 9.35
GBP and the cd's only take a few days to arrive via Royal Air mail.
Much better than the 30 dollars that they want for them at the local
Virgin Mega Store.

What a great time to be a XTC fan.  (By the way is there are name for
us?)

Cathryn

------------------------------

End of Chalkhills Digest #7-36
******************************

Go back to the previous page.